Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27552
Trapped Gene
AA960436 (ENSMUSG00000031792)
Vector Insertion
Chr 8: 97856366 - 97857267
Public Clones not available
Private Clones OST57005 (lexicon)
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000213038 (Chr8:97856203..97856365 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGCGGTTCAGAGGATGAAG Chr8:97856294..97856313 60.93 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000213038 (Chr8:97856203..97856365 +)
Downstram Exon
ENSMUSE00000213043 (Chr8:97857268..97857434 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGCGGTTCAGAGGATGAAG Chr8:97856294..97856313 60.93 55 CTTTGCACTGTCGTCCTCAG Chr8:97857370..97857389 59.62 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000213038 Chr8:97856203..97856365 CAGCGGTTCAGAGGATGAAG Chr8:97856294..97856313 60.93 55

*** Putative Vector Insertion (Chr 8: 97856366 - 97857267) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000213043 Chr8:97857268..97857434 CTTTGCACTGTCGTCCTCAG Chr8:97857370..97857389 59.62 55
downstream ENSMUSE00000213037 Chr8:97862534..97862717 ATCCAGTGGTGACGGAGAAC Chr8:97862672..97862691 59.97 55
downstream ENSMUSE00000213044 Chr8:97867022..97867075 ACCCTGTTGGCAGTAAAGAAGA Chr8:97867046..97867067 60.17 45.46
downstream ENSMUSE00000213042 Chr8:97867857..97867962 CTTCATGGCTCTGTCCACCT Chr8:97867938..97867957 60.26 55
downstream ENSMUSE00000213041 Chr8:97869189..97869272 No primer for this exon
downstream ENSMUSE00000382085 Chr8:97870427..97871407 GCCAGGCTCATTTGACTTTC Chr8:97870778..97870797 59.82 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGTGAGGATCGAGGAATTT Chr8:97856365..97856385 59.48 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCTTTTGAAACCCCGTGAC Chr8:97856403..97856423 59.95 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031792