Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27554
Trapped Gene
Sfrs12 (ENSMUSG00000032621)
Vector Insertion
Chr 13: 104559531 - 104564378
Public Clones 3SE139D08 (ggtc)
Private Clones OST56955 (lexicon) OST56736 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000679910 (Chr13:104564379..104564539 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTACGACGGTGATTCAGGT Chr13:104564472..104564491 59.99 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000679910 (Chr13:104564379..104564539 -)
Downstram Exon
ENSMUSE00000679909 (Chr13:104559397..104559530 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTACGACGGTGATTCAGGT Chr13:104564472..104564491 59.99 55 CACCAACACTTGATGGGTCA Chr13:104559441..104559460 60.42 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000679910 Chr13:104564379..104564539 CCTACGACGGTGATTCAGGT Chr13:104564472..104564491 59.99 55

*** Putative Vector Insertion (Chr 13: 104559531 - 104564378) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000679909 Chr13:104559397..104559530 CACCAACACTTGATGGGTCA Chr13:104559441..104559460 60.42 50
downstream ENSMUSE00000610802 Chr13:104553962..104554584 AGGTACCAGGCTTGTCATGG Chr13:104553994..104554013 59.99 55
downstream ENSMUSE00000679908 Chr13:104553962..104554086 AGGTACCAGGCTTGTCATGG Chr13:104553994..104554013 59.99 55
downstream ENSMUSE00000314908 Chr13:104551110..104551274 CTGGGATAGCTCCCAAACTG Chr13:104551216..104551235 59.69 55
downstream ENSMUSE00000314898 Chr13:104550496..104550674 AAGCAAGAGCCCTTGGTACA Chr13:104550508..104550527 59.88 50
downstream ENSMUSE00000314888 Chr13:104549249..104549379 AAATGACTGAGCCTCCCGTA Chr13:104549249..104549268 59.69 50
downstream ENSMUSE00000314878 Chr13:104548266..104548380 AGTGTGGGAACGAGATCGAC Chr13:104548309..104548328 60.12 55
downstream ENSMUSE00000314870 Chr13:104543105..104543224 CTTCCGCCTCTCCCTAGACT Chr13:104543106..104543125 59.97 60
downstream ENSMUSE00000406921 Chr13:104542474..104542782 GAGATCGTCGTGATGCATTG Chr13:104542465..104542484 60.23 50
downstream ENSMUSE00000314846 Chr13:104538839..104538934 TGGAAGAACTCCTGCTCCTC Chr13:104538878..104538897 59.53 55
downstream ENSMUSE00000314839 Chr13:104534865..104535009 CTGATGTGGTCCCGTTCTTT Chr13:104534940..104534959 59.97 50
downstream ENSMUSE00000438880 Chr13:104531695..104533796 CATTTTCTGGCAGACCCAAT Chr13:104532934..104532953 59.93 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTTGCCCTGGGTTCTACTT Chr13:104564394..104564414 60.63 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCTGGGTTCTACTTTTCTGG Chr13:104564388..104564409 59.98 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTAATCGCCTTGCAGCACAT Chr13:104564470..104564490 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000032621