Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27555
Trapped Gene
Agpat4 (ENSMUSG00000023827)
Vector Insertion
Chr 17: 12344816 - 12391617
Public Clones (sanger) D057E05 (ggtc) D057E05 (ggtc) (ggtc) E031F08 (ggtc)
(ggtc) IST14012G7 (tigm) IST12245E6BBF1 (tigm) IST12356E6 (tigm)
IST10341C9 (tigm) IST10077G5 (tigm) IST12766B9BBF1 (tigm) IST12696A10 (tigm)
Private Clones OST56949 (lexicon)
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000377093 (Chr17:12344558..12344815 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCTGTTCCGCAAGATCAAT Chr17:12344768..12344787 59.84 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000377093 (Chr17:12344558..12344815 +)
Downstram Exon
ENSMUSE00000371130 (Chr17:12391618..12391787 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCTGTTCCGCAAGATCAAT Chr17:12344768..12344787 59.84 45 CTTGTGATTGAGGACCACGA Chr17:12391733..12391752 59.68 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000336429 Chr17:12312150..12312281 TTGTGAGCACCAATGCAAAG Chr17:12312246..12312265 60.84 45
upstream ENSMUSE00000377093 Chr17:12344558..12344815 AGCTGTTCCGCAAGATCAAT Chr17:12344768..12344787 59.84 45

*** Putative Vector Insertion (Chr 17: 12344816 - 12391617) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000371130 Chr17:12391618..12391787 CTTGTGATTGAGGACCACGA Chr17:12391733..12391752 59.68 50
downstream ENSMUSE00000135585 Chr17:12403077..12403238 TCCACGAAGTACCACATCCA Chr17:12403150..12403169 59.96 50
downstream ENSMUSE00000135584 Chr17:12403505..12403658 CAACATCTCGCAAGCACTTC Chr17:12403661..12403680 59.6 50
downstream ENSMUSE00000135586 Chr17:12406321..12406423 AGCAGTGTTGGGTTTTCATTG Chr17:12406380..12406400 60.02 42.86
downstream ENSMUSE00000556040 Chr17:12408142..12408217 TGTGTAACCAGGCAGAGCAC Chr17:12408203..12408222 59.9 55
downstream ENSMUSE00000135582 Chr17:12409560..12409758 CCAGAACAACCAGTTGACCA Chr17:12409661..12409680 59.56 50
downstream ENSMUSE00000389483 Chr17:12411851..12412506 CAGTCCGTTTGTTTCCGTTT Chr17:12411947..12411966 60.01 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTCCTGTGGACAAATGCTT Chr17:12362846..12362866 59.97 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTCCTGTGGACAAATGCTT Chr17:12362846..12362866 59.97 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023827