Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27559
Trapped Gene
Chmp2a (ENSMUSG00000033916)
Vector Insertion
Chr 7: 13619392 - 13619983
Public Clones not available
Private Clones OST56841 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000286141 (Chr7:13619984..13620093 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAAACCCATCGTTCTCTCG Chr7:13619990..13620009 61.92 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000286141 (Chr7:13619984..13620093 -)
Downstram Exon
ENSMUSE00000286137 (Chr7:13619178..13619391 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAAACCCATCGTTCTCTCG Chr7:13619990..13620009 61.92 55 CTGGGACAACCGTCAGAACT Chr7:13619348..13619367 60.15 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000286141 Chr7:13619984..13620093 GGAAACCCATCGTTCTCTCG Chr7:13619990..13620009 61.92 55

*** Putative Vector Insertion (Chr 7: 13619392 - 13619983) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000286137 Chr7:13619178..13619391 CTGGGACAACCGTCAGAACT Chr7:13619348..13619367 60.15 55
downstream ENSMUSE00000286133 Chr7:13617991..13618170 GAGGGACACAGCTTGGATGT Chr7:13618053..13618072 60.12 55
downstream ENSMUSE00000198131 Chr7:13617784..13617914 No primer for this exon
downstream ENSMUSE00000198130 Chr7:13617638..13617699 No primer for this exon
downstream ENSMUSE00000286118 Chr7:13617368..13617551 GGGACAGGATGCACTGAGTT Chr7:13617368..13617387 60.12 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTGGTAGGCAGCGTAGGAT Chr7:13619931..13619951 59.73 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTGGTAGGCAGCGTAGGAC Chr7:13619931..13619951 60.27 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033916