Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27578
Trapped Gene
Mboat5 (ENSMUSG00000004270)
Vector Insertion
Chr 6: 124613378 - 124648087
Public Clones D125E06 (ggtc) IST10902E12 (tigm)
Private Clones OST56180 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000345554 (Chr6:124613194..124613377 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000345554 (Chr6:124613194..124613377 +)
Downstram Exon
ENSMUSE00000248623 (Chr6:124648088..124648195 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000345554 Chr6:124613194..124613377 No primer for this exon

*** Putative Vector Insertion (Chr 6: 124613378 - 124648087) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000248623 Chr6:124648088..124648195 No primer for this exon
downstream ENSMUSE00000195563 Chr6:124649257..124649363 No primer for this exon
downstream ENSMUSE00000195565 Chr6:124650025..124650118 No primer for this exon
downstream ENSMUSE00000195575 Chr6:124650259..124650296 No primer for this exon
downstream ENSMUSE00000195573 Chr6:124650691..124650869 No primer for this exon
downstream ENSMUSE00000195567 Chr6:124651487..124651595 No primer for this exon
downstream ENSMUSE00000195561 Chr6:124652254..124652340 No primer for this exon
downstream ENSMUSE00000195571 Chr6:124652430..124652596 No primer for this exon
downstream ENSMUSE00000195560 Chr6:124653024..124653171 No primer for this exon
downstream ENSMUSE00000195558 Chr6:124653245..124653403 No primer for this exon
downstream ENSMUSE00000248564 Chr6:124653513..124653645 No primer for this exon
downstream ENSMUSE00000378423 Chr6:124653818..124654187 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGAGACAAACGCAGGAGAA Chr6:124634361..124634381 59.99 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGAGACAAACGCAGGAGAA Chr6:124634361..124634381 59.99 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000004270