Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27585
Trapped Gene
Pdap1 (ENSMUSG00000029623)
Vector Insertion
Chr 5: 145893850 - 145895933
Public Clones not available
Private Clones OST56024 (lexicon)
Severity of mutation (?) Insertion after 39% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000190824 (Chr5:145895934..145896041 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000190824 (Chr5:145895934..145896041 -)
Downstram Exon
ENSMUSE00000190823 (Chr5:145893728..145893849 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AGATCCAGTTGCGTGACCTT Chr5:145893739..145893758 59.73 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000684841 Chr5:145900836..145900888 AGCCGAGATGCCTAAAGGAG Chr5:145900836..145900855 60.86 55
upstream ENSMUSE00000407837 Chr5:145897771..145897862 AGATCGATGCCCAGCTACAG Chr5:145897792..145897811 60.38 55
upstream ENSMUSE00000190824 Chr5:145895934..145896041 No primer for this exon

*** Putative Vector Insertion (Chr 5: 145893850 - 145895933) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000190823 Chr5:145893728..145893849 AGATCCAGTTGCGTGACCTT Chr5:145893739..145893758 59.73 50
downstream ENSMUSE00000190822 Chr5:145892234..145892385 CTCTGTCTTCCCAGCCAAAT Chr5:145892297..145892316 59.28 50
downstream ENSMUSE00000361483 Chr5:145890526..145891244 GCGTGCAATCTACTGGACAA Chr5:145890822..145890841 59.87 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAGACTGCAGGCCACACTCA Chr5:145895903..145895923 60.62 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAGACTGCAGGCCACACTCA Chr5:145895903..145895923 60.62 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029623