Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27590
Trapped Gene
D5Wsu178e (ENSMUSG00000075703)
Vector Insertion
Chr 5: 30559356 - 30574008
Public Clones not available
Private Clones OST55980 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000660051 (Chr5:30559158..30559355 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACGAATACGTGAGCCCAGAG Chr5:30559309..30559328 60.28 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000660051 (Chr5:30559158..30559355 +)
Downstram Exon
ENSMUSE00000274875 (Chr5:30574009..30574077 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACGAATACGTGAGCCCAGAG Chr5:30559309..30559328 60.28 55 GTTCCAAAATGGATGCATGA Chr5:30574068..30574087 59.33 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000660051 Chr5:30559158..30559355 ACGAATACGTGAGCCCAGAG Chr5:30559309..30559328 60.28 55

*** Putative Vector Insertion (Chr 5: 30559356 - 30574008) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000274875 Chr5:30574009..30574077 GTTCCAAAATGGATGCATGA Chr5:30574068..30574087 59.33 40
downstream ENSMUSE00000660011 Chr5:30574946..30575066 CAAGCAGCATAAAGCCAGAA Chr5:30575018..30575037 59.21 45
downstream ENSMUSE00000660012 Chr5:30579256..30579330 ACGACAATCCAAACCCAGTC Chr5:30579301..30579320 59.83 50
downstream ENSMUSE00000274862 Chr5:30582624..30582886 AACACACGACCAACTGTCCA Chr5:30582718..30582737 60.05 50
downstream ENSMUSE00000660010 Chr5:30584258..30584366 CCACAACCGCAGTCACTATG Chr5:30584297..30584316 60.17 55
downstream ENSMUSE00000660050 Chr5:30589617..30589665 No primer for this exon
downstream ENSMUSE00000660019 Chr5:30590821..30591001 ACTTGTGCTTCAGCGTGTTG Chr5:30590855..30590874 60.1 50
downstream ENSMUSE00000660018 Chr5:30591884..30592069 GCAGCCGTGAGTGTGTAAAG Chr5:30592035..30592054 59.51 55
downstream ENSMUSE00000660074 Chr5:30593447..30598976 GTTACCACCGTTAGGCAGGA Chr5:30597984..30598003 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr5:30562407..30562427 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTGTCGTGACTGGGAAAA Chr5:30562401..30562421 59.72 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000075703