Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27592
Trapped Gene
1110059E24Rik (ENSMUSG00000035171)
Vector Insertion
Chr 19: 21672825 - 21673244
Public Clones not available
Private Clones OST55866 (lexicon) OST32724 (lexicon)
Severity of mutation (?) Insertion after 69% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000252605 (Chr19:21673245..21673358 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTGCCAAATGTGGAAAGAA Chr19:21673263..21673282 60.09 40 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000252605 (Chr19:21673245..21673358 -)
Downstram Exon
ENSMUSE00000252581 (Chr19:21671803..21672824 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTGCCAAATGTGGAAAGAA Chr19:21673263..21673282 60.09 40 TTTCTGGAGCGTCTGGTTCT Chr19:21672774..21672793 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000377795 Chr19:21727097..21727281 AGGCTGCACCGATTTACAGT Chr19:21727215..21727234 59.76 50
upstream ENSMUSE00000252623 Chr19:21693599..21693705 GTCAGCGCTGCAAAGAAGTT Chr19:21693655..21693674 60.72 50
upstream ENSMUSE00000252605 Chr19:21673245..21673358 TGTGCCAAATGTGGAAAGAA Chr19:21673263..21673282 60.09 40

*** Putative Vector Insertion (Chr 19: 21672825 - 21673244) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000252581 Chr19:21671803..21672824 TTTCTGGAGCGTCTGGTTCT Chr19:21672774..21672793 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCCATGATAATCGCCTTGC Chr19:21673181..21673201 59.89 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGACGTGACTGGGAAAACC Chr19:21673177..21673197 59.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035171