Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27595
Trapped Gene
Depdc5 (ENSMUSG00000037426)
Vector Insertion
Chr 5: 33236103 - 33238528
Public Clones IST14248G6 (tigm)
Private Clones OST55789 (lexicon)
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000246481 (Chr5:33236024..33236102 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGTTCTACGTCGGCTATGGT Chr5:33236033..33236052 60.15 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000246481 (Chr5:33236024..33236102 +)
Downstram Exon
ENSMUSE00000719751 (Chr5:33238529..33238583 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGTTCTACGTCGGCTATGGT Chr5:33236033..33236052 60.15 55 AAACCGTTCACAGCTTTCTCA Chr5:33238564..33238584 59.91 42.86

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000719988 Chr5:33206355..33206392 No primer for this exon
upstream ENSMUSE00000548842 Chr5:33206370..33206470 CTGGTTCCTAGAGCCCTGGT Chr5:33206421..33206440 60.64 60
upstream ENSMUSE00000709217 Chr5:33206383..33206470 CTGGTTCCTAGAGCCCTGGT Chr5:33206421..33206440 60.64 60
upstream ENSMUSE00000548597 Chr5:33206426..33206470 No primer for this exon
upstream ENSMUSE00000548840 Chr5:33206659..33206961 GTTAGTGGACCGCGAGTCAT Chr5:33206813..33206832 60.14 55
upstream ENSMUSE00000548839 Chr5:33207226..33207348 GCAAGATGACTTCCCTGCTC Chr5:33207236..33207255 59.96 55
upstream ENSMUSE00000713002 Chr5:33207226..33207348 GCAAGATGACTTCCCTGCTC Chr5:33207236..33207255 59.96 55
upstream ENSMUSE00000712196 Chr5:33207236..33207348 GCAAGATGACTTCCCTGCTC Chr5:33207236..33207255 59.96 55
upstream ENSMUSE00000246530 Chr5:33210623..33210710 AGATTGCTCACCCCAATGAT Chr5:33210683..33210702 59.37 45
upstream ENSMUSE00000246520 Chr5:33211470..33211516 TCCTTTGCTTTTGCAAGTCA Chr5:33211470..33211489 59.58 40
upstream ENSMUSE00000548645 Chr5:33217931..33218016 No primer for this exon
upstream ENSMUSE00000246508 Chr5:33219719..33219802 GGGGATATGTGGCGACTAAA Chr5:33219773..33219792 59.78 50
upstream ENSMUSE00000699470 Chr5:33219719..33219754 TGACTCTTGACCTGGTGGAA Chr5:33219723..33219742 59.23 50
upstream ENSMUSE00000246498 Chr5:33221277..33221326 AAGTGGAATTTGCTGGCATC Chr5:33221305..33221324 60.08 45
upstream ENSMUSE00000460817 Chr5:33221285..33221326 AAGTGGAATTTGCTGGCATC Chr5:33221305..33221324 60.08 45
upstream ENSMUSE00000246488 Chr5:33229628..33229697 AGCTGTGGGTCAAGAATGAGA Chr5:33229642..33229662 59.86 47.62
upstream ENSMUSE00000246481 Chr5:33236024..33236102 CGTTCTACGTCGGCTATGGT Chr5:33236033..33236052 60.15 55

*** Putative Vector Insertion (Chr 5: 33236103 - 33238528) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000246476 Chr5:33238529..33238590 AAACCGTTCACAGCTTTCTCA Chr5:33238564..33238584 59.91 42.86
downstream ENSMUSE00000719751 Chr5:33238529..33238583 AAACCGTTCACAGCTTTCTCA Chr5:33238564..33238584 59.91 42.86
downstream ENSMUSE00000246470 Chr5:33240528..33240597 TTCTGGAAAACAGGACCACAG Chr5:33240575..33240595 60.13 47.62
downstream ENSMUSE00000246463 Chr5:33241641..33241713 TCCCTTTGTGATCCTCTTGAA Chr5:33241693..33241713 59.66 42.86
downstream ENSMUSE00000246456 Chr5:33244105..33244208 TCTCTCATTCTGCACCACCA Chr5:33244129..33244148 60.4 50
downstream ENSMUSE00000246450 Chr5:33244479..33244553 GGTAGTTTCCTTGTGCTGAGGT Chr5:33244527..33244548 59.68 50
downstream ENSMUSE00000246441 Chr5:33246426..33246560 ATCATGAGTAGGCGGTCCAC Chr5:33246534..33246553 59.96 55
downstream ENSMUSE00000246433 Chr5:33246924..33246985 CACAGCATGTAGTGGCTGCT Chr5:33246976..33246995 60.08 55
downstream ENSMUSE00000246426 Chr5:33247108..33247181 TCGGAACACTCCGGTTATGT Chr5:33247132..33247151 60.38 50
downstream ENSMUSE00000384063 Chr5:33253106..33253175 GAGCTGGCTTTTGGATGTGT Chr5:33253133..33253152 60.26 50
downstream ENSMUSE00000351488 Chr5:33254858..33254894 No primer for this exon
downstream ENSMUSE00000361342 Chr5:33255749..33255869 GATGGGAAGGGTGTTTTCAG Chr5:33255792..33255811 59.38 50
downstream ENSMUSE00000391397 Chr5:33260574..33260794 TTGCGACTGTGATTCTCCTG Chr5:33260609..33260628 59.98 50
downstream ENSMUSE00000405364 Chr5:33266811..33267014 GCTCTCTGAGGCGTGTATCC Chr5:33266934..33266953 59.98 60
downstream ENSMUSE00000246399 Chr5:33269539..33269674 TCATGGTATGCCAACTCCAA Chr5:33269665..33269684 59.92 45
downstream ENSMUSE00000246392 Chr5:33270494..33270588 AAGCTCTTCCGTTCCACTGA Chr5:33270560..33270579 59.99 50
downstream ENSMUSE00000246385 Chr5:33276599..33276664 No primer for this exon
downstream ENSMUSE00000548616 Chr5:33280170..33280353 GGTCCGGGAAGTAGTCAGTG Chr5:33280289..33280308 59.57 60
downstream ENSMUSE00000382712 Chr5:33280197..33280353 GGTCCGGGAAGTAGTCAGTG Chr5:33280289..33280308 59.57 60
downstream ENSMUSE00000246369 Chr5:33280794..33280954 ACGCTGGCAGATGAACTCTT Chr5:33280860..33280879 60.02 50
downstream ENSMUSE00000246639 Chr5:33285881..33285998 CCAATACTGGCCTTCCTCCT Chr5:33285927..33285946 60.46 55
downstream ENSMUSE00000413129 Chr5:33286620..33286787 TTGTATTCCTCGAGCCGTTC Chr5:33286739..33286758 60.21 50
downstream ENSMUSE00000350234 Chr5:33287572..33287791 GGATGCGATTTAAGCCCTCT Chr5:33287762..33287781 60.55 50
downstream ENSMUSE00000246610 Chr5:33289283..33289416 AGGTTCCTTTCTTGCCGACT Chr5:33289379..33289398 60.25 50
downstream ENSMUSE00000246598 Chr5:33298502..33298607 GTGCACAGTCGTCTGCTGTT Chr5:33298535..33298554 60.1 55
downstream ENSMUSE00000548576 Chr5:33298778..33298949 GGTGCTTCAGGAACTTCCAA Chr5:33298900..33298919 60.23 50
downstream ENSMUSE00000699441 Chr5:33298778..33298804 No primer for this exon
downstream ENSMUSE00000548614 Chr5:33301930..33301995 GCTGCGGACAAACTCCATAA Chr5:33301965..33301984 61.17 50
downstream ENSMUSE00000246589 Chr5:33307281..33307432 GGAGTTCCCAAAGGTCTGGT Chr5:33307388..33307407 60.35 55
downstream ENSMUSE00000405684 Chr5:33310380..33310457 CCAGAATCTCCACCAGGGTA Chr5:33310441..33310460 59.92 55
downstream ENSMUSE00000246572 Chr5:33311288..33311420 ACCAGTGTACGACCTCAGCA Chr5:33311367..33311386 59.34 55
downstream ENSMUSE00000246563 Chr5:33316466..33316574 TCACCAGATGCATGCGTTAT Chr5:33316509..33316528 60.1 45
downstream ENSMUSE00000246556 Chr5:33317966..33318193 CTTCGGCTAAAGGAGCTGTG Chr5:33318161..33318180 60.15 55
downstream ENSMUSE00000246364 Chr5:33322034..33322203 TCACTGCCATCCAGTGTAGC Chr5:33322183..33322202 59.86 55
downstream ENSMUSE00000246359 Chr5:33326508..33326679 TAGCTTTTCGATGCCAACCT Chr5:33326535..33326554 59.85 45
downstream ENSMUSE00000246355 Chr5:33329585..33329645 CAATGGCTTCCTGGAAAAGA Chr5:33329641..33329660 60.18 45
downstream ENSMUSE00000601014 Chr5:33333391..33333473 No primer for this exon
downstream ENSMUSE00000601015 Chr5:33333391..33333473 No primer for this exon
downstream ENSMUSE00000413171 Chr5:33333588..33334209 ACTCACTCCCACGGACAATC Chr5:33334124..33334143 59.97 55
downstream ENSMUSE00000548673 Chr5:33333588..33334209 ACTCACTCCCACGGACAATC Chr5:33334124..33334143 59.97 55
downstream ENSMUSE00000710102 Chr5:33333588..33334317 ACTCACTCCCACGGACAATC Chr5:33334124..33334143 59.97 55
downstream ENSMUSE00000710946 Chr5:33333588..33334310 ACTCACTCCCACGGACAATC Chr5:33334124..33334143 59.97 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCACTGGGAAGAACTCTTGG Chr5:33236134..33236154 59.84 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCACTGGGAAGAACTCTTGG Chr5:33236134..33236154 59.84 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037426