Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27602
Trapped Gene
Nedd4l (ENSMUSG00000024589)
Vector Insertion
Chr 18: 65234377 - 65234460
Public Clones not available
Private Clones OST55601 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000490598 (Chr18:65234378..65234459 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCCATACGTGAAGCTGTCC Chr18:65234380..65234399 60 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000490598 (Chr18:65234378..65234459 +)
Downstram Exon
ENSMUSE00000625272 (Chr18:65234378..65234459 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCCATACGTGAAGCTGTCC Chr18:65234380..65234399 60 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000444297 Chr18:65080790..65080921 AGTTCATGTGGGGGACAAAG Chr18:65080810..65080829 59.82 50
upstream ENSMUSE00000444290 Chr18:65157002..65157075 GAATTGACCTCGCCAAGAAG Chr18:65157039..65157058 59.81 50
upstream ENSMUSE00000625273 Chr18:65183548..65183643 CGCTCCCTTTTAGAGGAGGT Chr18:65183606..65183625 59.84 55
upstream ENSMUSE00000572286 Chr18:65210696..65210826 CAACACCAGTCCAACAGCAC Chr18:65210768..65210787 60.2 55

*** Putative Vector Insertion (Chr 18: 65234377 - 65234460) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000490598 Chr18:65234378..65234459 No primer for this exon
downstream ENSMUSE00000625272 Chr18:65234378..65234459 No primer for this exon
downstream ENSMUSE00000404722 Chr18:65237352..65237390 CTTCATTCCACTTTGGGTTCA Chr18:65237378..65237398 59.96 42.86
downstream ENSMUSE00000625271 Chr18:65237352..65237390 CTTCATTCCACTTTGGGTTCA Chr18:65237378..65237398 59.96 42.86
downstream ENSMUSE00000444257 Chr18:65239672..65239725 GGAGCCTGTGATTAGATGGATT Chr18:65239697..65239718 59.45 45.46
downstream ENSMUSE00000625270 Chr18:65239672..65239725 GGAGCCTGTGATTAGATGGATT Chr18:65239697..65239718 59.45 45.46
downstream ENSMUSE00000403425 Chr18:65303450..65303500 No primer for this exon
downstream ENSMUSE00000625269 Chr18:65303450..65303500 No primer for this exon
downstream ENSMUSE00000444212 Chr18:65314910..65314971 TAGGGTCTCTCCATGGTTGG Chr18:65314941..65314960 59.92 55
downstream ENSMUSE00000572288 Chr18:65314910..65314971 TAGGGTCTCTCCATGGTTGG Chr18:65314941..65314960 59.92 55
downstream ENSMUSE00000143543 Chr18:65315300..65315402 TCTGCTCGCTGTTTTCTTCA Chr18:65315391..65315410 59.86 45
downstream ENSMUSE00000143550 Chr18:65317499..65317665 AGTTCGGCCTAAATTGTCCA Chr18:65317615..65317634 59.57 45
downstream ENSMUSE00000143546 Chr18:65321169..65321304 TCACTAATGTGCCTCCGAGA Chr18:65321261..65321280 59.39 50
downstream ENSMUSE00000318921 Chr18:65322649..65322825 AACTGAACTGTTCCCCGTTG Chr18:65322820..65322839 60.01 50
downstream ENSMUSE00000318885 Chr18:65325226..65325300 CAACCGTGTCGGTAACACTG Chr18:65325280..65325299 60.06 55
downstream ENSMUSE00000318861 Chr18:65327168..65327227 ACCCGTGACAGTTGACGAAC Chr18:65327215..65327234 61.03 55
downstream ENSMUSE00000143539 Chr18:65331929..65332060 TTCTTTCTTCCCAGCCTGAA Chr18:65331989..65332008 59.93 45
downstream ENSMUSE00000143557 Chr18:65332570..65332689 CTCCAGTGGGGCAGATAAAG Chr18:65332692..65332711 59.69 55
downstream ENSMUSE00000143561 Chr18:65333699..65333896 GTTGGGGGCTATCCTCATCT Chr18:65333854..65333873 60.29 55
downstream ENSMUSE00000143554 Chr18:65338573..65338650 TGGAAATTTCAACCGTGGAT Chr18:65338599..65338618 60.17 40
downstream ENSMUSE00000143558 Chr18:65340982..65341036 TCCAAGTGGATCCTCTCTTCC Chr18:65341012..65341032 60.58 52.38
downstream ENSMUSE00000143542 Chr18:65345980..65346038 TGATGGCTGGGTTCTGTAGTC Chr18:65346032..65346052 60.13 52.38
downstream ENSMUSE00000143553 Chr18:65351091..65351156 No primer for this exon
downstream ENSMUSE00000318699 Chr18:65352730..65352959 CCACAGCCTAGCCTTTAGGA Chr18:65352846..65352865 59.47 55
downstream ENSMUSE00000143545 Chr18:65354714..65354835 CTAGGCCAGCAACTCTTCCA Chr18:65354811..65354830 60.53 55
downstream ENSMUSE00000472197 Chr18:65355569..65355639 TGTCGTTCAGCGTTATCTGC Chr18:65355631..65355650 60.02 50
downstream ENSMUSE00000572285 Chr18:65358285..65358380 CTGCCCAAAGTTCTCTTCGT Chr18:65358383..65358402 59.47 50
downstream ENSMUSE00000347968 Chr18:65363530..65363603 GGGCTTCAGATCCACTTGGT Chr18:65363556..65363575 61.43 55
downstream ENSMUSE00000318611 Chr18:65365287..65365347 TTCTGGACCCTGTTCACAAA Chr18:65365328..65365347 59.11 45
downstream ENSMUSE00000572284 Chr18:65367703..65367762 No primer for this exon
downstream ENSMUSE00000143541 Chr18:65368046..65368153 TGCTGTCTCCAGTCGTTCAC Chr18:65368098..65368117 60.03 55
downstream ENSMUSE00000143555 Chr18:65369307..65369403 AGTTCGGCAAATCCATTCAT Chr18:65369401..65369420 59.39 40
downstream ENSMUSE00000143548 Chr18:65369917..65369989 TGGGTAGTTTTTCGGGACTG Chr18:65369979..65369998 59.96 50
downstream ENSMUSE00000625268 Chr18:65372438..65372961 ATCAGTGTACACGGCAACCA Chr18:65372766..65372785 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr18:65234427..65234447 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGACCCATACGTGAAGCTGT Chr18:65234379..65234399 61.12 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024589