Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27610
Trapped Gene
Whsc1l1 (ENSMUSG00000054823)
Vector Insertion
Chr 8: 26750755 - 26751798
Public Clones not available
Private Clones OST55254 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000378384 (Chr8:26750756..26751797 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTCATCTCGATCCGAAGAGC Chr8:26751734..26751753 59.92 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000378384 (Chr8:26750756..26751797 +)
Downstram Exon
ENSMUSE00000608917 (Chr8:26751519..26751797 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTCATCTCGATCCGAAGAGC Chr8:26751734..26751753 59.92 55 GCTCTTCGGATCGAGATGAC Chr8:26751756..26751775 59.92 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC

*** Putative Vector Insertion (Chr 8: 26750755 - 26751798) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000378384 Chr8:26750756..26751797 GCTCTTCGGATCGAGATGAC Chr8:26751756..26751775 59.92 55
downstream ENSMUSE00000608918 Chr8:26751093..26751488 GTTGGCCGAGTCAATGAGTT Chr8:26751176..26751195 60.12 50
downstream ENSMUSE00000608917 Chr8:26751519..26751797 GCTCTTCGGATCGAGATGAC Chr8:26751756..26751775 59.92 55
downstream ENSMUSE00000210825 Chr8:26758913..26758984 CTTCTCTGGTGCAGTGTCCA Chr8:26758951..26758970 60.02 55
downstream ENSMUSE00000210826 Chr8:26760013..26760175 TGGACCAAACAAGATCACCA Chr8:26760097..26760116 59.94 45
downstream ENSMUSE00000210827 Chr8:26770213..26770367 TGTATTCCCGTACCCGTTTC Chr8:26770296..26770315 59.69 50
downstream ENSMUSE00000253047 Chr8:26773213..26773728 TTCCAGGCGATTTTAACAGG Chr8:26773562..26773581 60.07 45
downstream ENSMUSE00000253039 Chr8:26776502..26776628 TGCCCCCTGACACTTATTTC Chr8:26776542..26776561 59.93 50
downstream ENSMUSE00000210820 Chr8:26783806..26783906 TCAGATCGAGTCCTGATGGA Chr8:26783857..26783876 59.29 50
downstream ENSMUSE00000210824 Chr8:26786169..26786214 No primer for this exon
downstream ENSMUSE00000394100 Chr8:26787175..26787257 GAGACGGAGCTGTCACTGAA Chr8:26787232..26787251 59.13 55
downstream ENSMUSE00000608916 Chr8:26789188..26789318 ACGTGCAACTAGCCGTCTCT Chr8:26789274..26789293 60.08 55
downstream ENSMUSE00000608915 Chr8:26790338..26790466 GCAGTAGCTGACGGGCTATC Chr8:26790381..26790400 60.01 60
downstream ENSMUSE00000608914 Chr8:26791120..26791246 CACTCCACGTGAAAGTGTCG Chr8:26791193..26791212 60.35 55
downstream ENSMUSE00000252941 Chr8:26792971..26793168 GACAGCGGAATCCTTTTGAC Chr8:26793114..26793133 59.68 50
downstream ENSMUSE00000470325 Chr8:26793624..26793794 CAGATGAGAATGTGCGAGGA Chr8:26793726..26793745 59.94 50
downstream ENSMUSE00000608913 Chr8:26801487..26801633 GGAAGCTGACGAAGAAGGAA Chr8:26801617..26801636 59.55 50
downstream ENSMUSE00000252927 Chr8:26805161..26805326 TTTCCCAATTTGACCCAAAC Chr8:26805314..26805333 59.64 40
downstream ENSMUSE00000252922 Chr8:26809205..26809407 CAAAGAAGAACACGGGGAAG Chr8:26809302..26809321 59.71 50
downstream ENSMUSE00000252916 Chr8:26810383..26810495 CTGGAAACGTTTTGCAGCTT Chr8:26810414..26810433 60.42 45
downstream ENSMUSE00000252907 Chr8:26810923..26811192 TGTTCAGACACTGCGACTCC Chr8:26811043..26811062 60.03 55
downstream ENSMUSE00000252903 Chr8:26816996..26817112 TGATTCGGAGTCTGCACTCTT Chr8:26817061..26817081 60.01 47.62
downstream ENSMUSE00000608911 Chr8:26819535..26819676 TCCAACTCGAACGTCTCCAT Chr8:26819651..26819670 60.66 50
downstream ENSMUSE00000252888 Chr8:26821145..26821251 GTTGCCCAGACAGTCCAAGT Chr8:26821191..26821210 60.16 55
downstream ENSMUSE00000252881 Chr8:26823830..26824031 GGTGGTAAGCTTTGGGACAG Chr8:26824001..26824020 59.59 55
downstream ENSMUSE00000523236 Chr8:26824631..26830139 AGCCAACGTTCTGCTTCCTA Chr8:26827151..26827170 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr8:26750806..26750826 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGGAAGTAAGCAGGCGTGA Chr8:26750791..26750811 60.8 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000054823