Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27611
Trapped Gene
3010026O09Rik (ENSMUSG00000020381)
Vector Insertion
Chr 11: 49990389 - 49995993
Public Clones not available
Private Clones OST55228 (lexicon)
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000297335 (Chr11:49990329..49990388 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000297335 (Chr11:49990329..49990388 +)
Downstram Exon
ENSMUSE00000297326 (Chr11:49995994..49996082 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000297344 Chr11:49988379..49988453 No primer for this exon
upstream ENSMUSE00000297335 Chr11:49990329..49990388 No primer for this exon

*** Putative Vector Insertion (Chr 11: 49990389 - 49995993) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000297326 Chr11:49995994..49996082 No primer for this exon
downstream ENSMUSE00000297317 Chr11:50007710..50007785 No primer for this exon
downstream ENSMUSE00000297307 Chr11:50010446..50010594 No primer for this exon
downstream ENSMUSE00000103994 Chr11:50011121..50011205 No primer for this exon
downstream ENSMUSE00000460105 Chr11:50013038..50013614 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGAAGGCCAAAGCCAGTCT Chr11:49990372..49990392 60.9 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGTCGTGACTGGGAAAACC Chr11:49990436..49990456 60.93 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020381