Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27625
Trapped Gene
4931406P16Rik (ENSMUSG00000066571)
Vector Insertion
Chr 7: 35027425 - 35029984
Public Clones not available
Private Clones OST55050 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000533575 (Chr7:35029985..35030997 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCCACTGATCAGGAAATGC Chr7:35030567..35030586 59.93 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000533575 (Chr7:35029985..35030997 -)
Downstram Exon
ENSMUSE00000533568 (Chr7:35027259..35027424 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCCACTGATCAGGAAATGC Chr7:35030567..35030586 59.93 50 GTGCGAATTCTGGGTCTGAG Chr7:35027379..35027398 60.8 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000675469 Chr7:35098511..35098566 No primer for this exon
upstream ENSMUSE00000675472 Chr7:35098506..35098570 No primer for this exon
upstream ENSMUSE00000533608 Chr7:35069721..35070618 GCCGTGCTAGTACGTTCCTC Chr7:35069925..35069944 59.9 60
upstream ENSMUSE00000675471 Chr7:35069721..35070972 AGTAACCCCTTCCGCCTAAA Chr7:35070646..35070665 59.96 50
upstream ENSMUSE00000675468 Chr7:35068984..35070972 AGTAACCCCTTCCGCCTAAA Chr7:35070646..35070665 59.96 50
upstream ENSMUSE00000533605 Chr7:35048572..35048769 GGTGCAAGTCCATTTCCAGT Chr7:35048724..35048743 59.97 50
upstream ENSMUSE00000533601 Chr7:35043032..35043172 AGAGAGGCTGTGATGGATGC Chr7:35043134..35043153 60.38 55
upstream ENSMUSE00000533598 Chr7:35042651..35042746 TTGGAAAGCTTAGGCCACTG Chr7:35042712..35042731 60.38 50
upstream ENSMUSE00000533593 Chr7:35042366..35042527 GCAGATAGGATCGCACTTCC Chr7:35042419..35042438 59.8 55
upstream ENSMUSE00000533588 Chr7:35041431..35041589 TGCCTGTAAGACTGCTGTGC Chr7:35041457..35041476 60.21 55
upstream ENSMUSE00000533585 Chr7:35039006..35039103 GGTTCAAGTCCCATCCACAT Chr7:35039007..35039026 59.64 50
upstream ENSMUSE00000533581 Chr7:35033126..35033251 CTAAACCGCTGGAGAACAGG Chr7:35033129..35033148 59.87 55
upstream ENSMUSE00000533575 Chr7:35029985..35030997 ACCCACTGATCAGGAAATGC Chr7:35030567..35030586 59.93 50

*** Putative Vector Insertion (Chr 7: 35027425 - 35029984) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000533568 Chr7:35027259..35027424 GTGCGAATTCTGGGTCTGAG Chr7:35027379..35027398 60.8 55
downstream ENSMUSE00000533565 Chr7:35025528..35025665 GAGTCTCCCTGAGCTCCTGA Chr7:35025602..35025621 59.66 60
downstream ENSMUSE00000533560 Chr7:35024763..35024841 CTGTGGTCAGGAGAGGTGGT Chr7:35024758..35024777 60.15 60
downstream ENSMUSE00000533556 Chr7:35021733..35024256 CCCACATGCAGGACTACCTT Chr7:35023594..35023613 59.99 55
downstream ENSMUSE00000675470 Chr7:35021726..35024256 CCCACATGCAGGACTACCTT Chr7:35023594..35023613 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTTGGAATGCTGGGAGAGA Chr7:35030004..35030024 60.33 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTTGGAATGCTGGGAGAGA Chr7:35030004..35030024 60.33 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000066571