Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27634
Trapped Gene
Pctk1 (ENSMUSG00000031065)
Vector Insertion
Chr X: 20265933 - 20270449
Public Clones not available
Private Clones OST54942 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000399983 (ChrX:20265560..20265932 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCCATGGCCGAAGACTACT ChrX:20265793..20265812 61.17 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000399983 (ChrX:20265560..20265932 +)
Downstram Exon
ENSMUSE00000718024 (ChrX:20270450..20270657 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCCATGGCCGAAGACTACT ChrX:20265793..20265812 61.17 55 TCATCCAGGCCTATCTGCTC ChrX:20270562..20270581 60.33 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000702605 ChrX:20265080..20265487 TTGCAAAAGTCCCGTTTACC ChrX:20265235..20265254 59.97 45
upstream ENSMUSE00000399983 ChrX:20265560..20265932 AGCCATGGCCGAAGACTACT ChrX:20265793..20265812 61.17 55

*** Putative Vector Insertion (Chr X: 20265933 - 20270449) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000713377 ChrX:20270450..20270657 TCATCCAGGCCTATCTGCTC ChrX:20270562..20270581 60.33 55
downstream ENSMUSE00000718024 ChrX:20270450..20270657 TCATCCAGGCCTATCTGCTC ChrX:20270562..20270581 60.33 55
downstream ENSMUSE00000702602 ChrX:20271033..20271297 TGGAGACTGCACCTCATCTG ChrX:20271252..20271271 59.98 55
downstream ENSMUSE00000205867 ChrX:20271164..20271297 TGGAGACTGCACCTCATCTG ChrX:20271252..20271271 59.98 55
downstream ENSMUSE00000205885 ChrX:20271397..20271522 GCTGGTAGTGACAGGCGTTT ChrX:20271428..20271447 60.32 55
downstream ENSMUSE00000205861 ChrX:20271615..20271671 CCCAGCTTGTCTAGCTTGATG ChrX:20271669..20271689 60.02 52.38
downstream ENSMUSE00000556954 ChrX:20271758..20271872 CCCTTCTTCGTGTTCCAGTC ChrX:20271850..20271869 59.7 55
downstream ENSMUSE00000205878 ChrX:20272636..20272730 GATGTTGGCATGCTTGAGGT ChrX:20272673..20272692 61.08 50
downstream ENSMUSE00000205882 ChrX:20272825..20272887 No primer for this exon
downstream ENSMUSE00000205866 ChrX:20273144..20273267 GCTTGAGGTCTCGGTGTAGC ChrX:20273219..20273238 60.02 60
downstream ENSMUSE00000205876 ChrX:20273473..20273593 AGGAATTGACTTGGCACGAG ChrX:20273501..20273520 60.26 50
downstream ENSMUSE00000205864 ChrX:20273674..20273771 CCAAAATGCGGAAGATGAAG ChrX:20273774..20273793 60.58 45
downstream ENSMUSE00000205884 ChrX:20273857..20273962 GGCTCGGTACTTGGGGTAGT ChrX:20273939..20273958 60.38 60
downstream ENSMUSE00000205880 ChrX:20274048..20274090 AGGTCAGCTCCATCGCTATC ChrX:20274074..20274093 59.42 55
downstream ENSMUSE00000205871 ChrX:20274246..20274336 TCCTCAGCAGAGATCCGATT ChrX:20274280..20274299 59.91 50
downstream ENSMUSE00000205873 ChrX:20275577..20275654 AGAAGTGGACCGAATGTTGG ChrX:20275644..20275663 59.97 50
downstream ENSMUSE00000624569 ChrX:20275735..20276011 GGTATCCACCACACGGAAAG ChrX:20275766..20275785 60.23 55
downstream ENSMUSE00000702601 ChrX:20275735..20277006 AGAGCCCCTACTCAACAGCA ChrX:20276717..20276736 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT ChrX:20268983..20269003 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCATTTAGGTCCGTGACTG ChrX:20268972..20268992 60.37 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031065