Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27638
Trapped Gene
Sall4 (ENSMUSG00000027547)
Vector Insertion
Chr 2: 168575961 - 168577953
Public Clones not available
Private Clones OST54922 (lexicon)
Severity of mutation (?) Insertion after 49% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000232199 (Chr2:168577954..168578240 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAGAGAAGCCTTTCGTGTG Chr2:168577997..168578016 59.99 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000232199 (Chr2:168577954..168578240 -)
Downstram Exon
ENSMUSE00000661186 (Chr2:168573832..168575960 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAGAGAAGCCTTTCGTGTG Chr2:168577997..168578016 59.99 55 TACCCGCATTAGTCACCACA Chr2:168574996..168575015 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000708679 Chr2:168592412..168592701 AGCACATCAACTGGGAGGAG Chr2:168592482..168592501 60.26 55
upstream ENSMUSE00000711707 Chr2:168592412..168592701 AGCACATCAACTGGGAGGAG Chr2:168592482..168592501 60.26 55
upstream ENSMUSE00000719112 Chr2:168592412..168592701 AGCACATCAACTGGGAGGAG Chr2:168592482..168592501 60.26 55
upstream ENSMUSE00000679259 Chr2:168590594..168590618 No primer for this exon
upstream ENSMUSE00000661187 Chr2:168581266..168582300 TCTCAGCAAGTGTCCGTGTC Chr2:168581622..168581641 60.03 55
upstream ENSMUSE00000679262 Chr2:168581266..168582300 TCTCAGCAAGTGTCCGTGTC Chr2:168581622..168581641 60.03 55
upstream ENSMUSE00000679260 Chr2:168580415..168580629 CGACCGTAAAGACCCAACAT Chr2:168580520..168580539 59.85 50
upstream ENSMUSE00000708693 Chr2:168579934..168582300 GCTCGACCAGTCCAAGAAAG Chr2:168581341..168581360 59.99 55
upstream ENSMUSE00000709955 Chr2:168579934..168582300 GCTCGACCAGTCCAAGAAAG Chr2:168581341..168581360 59.99 55
upstream ENSMUSE00000232199 Chr2:168577954..168578240 GGAGAGAAGCCTTTCGTGTG Chr2:168577997..168578016 59.99 55
upstream ENSMUSE00000706061 Chr2:168577954..168578240 GGAGAGAAGCCTTTCGTGTG Chr2:168577997..168578016 59.99 55

*** Putative Vector Insertion (Chr 2: 168575961 - 168577953) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000706060 Chr2:168575306..168575960 TAGGATTGCCCAAGGCTATG Chr2:168575343..168575362 60.05 50
downstream ENSMUSE00000661186 Chr2:168573832..168575960 TACCCGCATTAGTCACCACA Chr2:168574996..168575015 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGTGTGTGACGTCTGTGTG Chr2:168577914..168577934 60.26 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGTGTGTGACGTCTGTGTG Chr2:168577914..168577934 60.26 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027547