Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27652
Trapped Gene
Stmn2 (ENSMUSG00000027500)
Vector Insertion
Chr 3: 8509631 - 8541840
Public Clones (sanger) D142G07 (ggtc) IST14705H1 (tigm) IST14757B9 (tigm) IST12137H5 (tigm)
IST14773D7 (tigm) IST15050B7 (tigm)
Private Clones OST54600 (lexicon) OST45085 (lexicon) OST44548 (lexicon) OST42136 (lexicon)
OST38802 (lexicon) OST33316 (lexicon)
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000705955 (Chr3:8509565..8509630 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000705955 (Chr3:8509565..8509630 +)
Downstram Exon
ENSMUSE00000311839 (Chr3:8541841..8541936 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GCAGGAGCAGATCAGTGACA Chr3:8541896..8541915 60.15 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000382200 Chr3:8509521..8509630 ACAGCTGGACCCTTCTCCTT Chr3:8509555..8509574 60.25 55
upstream ENSMUSE00000705955 Chr3:8509565..8509630 No primer for this exon

*** Putative Vector Insertion (Chr 3: 8509631 - 8541840) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000311839 Chr3:8541841..8541936 GCAGGAGCAGATCAGTGACA Chr3:8541896..8541915 60.15 55
downstream ENSMUSE00000170117 Chr3:8545573..8545745 GGTGGCTTCAAGATCAGCTC Chr3:8545642..8545661 59.96 55
downstream ENSMUSE00000569583 Chr3:8554792..8554983 TTTCCTGCAGACGTTCAATG Chr3:8554984..8555003 59.84 45
downstream ENSMUSE00000170122 Chr3:8560266..8561604 TAATGCAGCAACCAGCTCAC Chr3:8561280..8561299 60.02 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGCAGACACTGAATGCACA Chr3:8539635..8539655 59.6 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGCAGACACTGAATGCACA Chr3:8539635..8539655 59.6 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027500