Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27694
Trapped Gene
Dock3 (ENSMUSG00000039716)
Vector Insertion
Chr 9: 107081496 - 107133802
Public Clones not available
Private Clones OST53114 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000520818 (Chr9:107133803..107134190 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACGGAGGAGGAGAAATACG Chr9:107133809..107133828 59.69 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000520818 (Chr9:107133803..107134190 -)
Downstram Exon
ENSMUSE00000358697 (Chr9:107081412..107081495 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACGGAGGAGGAGAAATACG Chr9:107133809..107133828 59.69 55 CAGATCCTCGAAAGCTGCAT Chr9:107081450..107081469 60.5 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000520818 Chr9:107133803..107134190 CACGGAGGAGGAGAAATACG Chr9:107133809..107133828 59.69 55

*** Putative Vector Insertion (Chr 9: 107081496 - 107133802) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000358697 Chr9:107081412..107081495 CAGATCCTCGAAAGCTGCAT Chr9:107081450..107081469 60.5 50
downstream ENSMUSE00000400349 Chr9:107061746..107061786 No primer for this exon
downstream ENSMUSE00000351933 Chr9:107037118..107037173 No primer for this exon
downstream ENSMUSE00000257238 Chr9:107010691..107010787 TAGAATCTTCCAGCGGAACC Chr9:107010731..107010750 59.27 50
downstream ENSMUSE00000257200 Chr9:106984706..106984854 ATTCATCACATGGCGGAGTT Chr9:106984788..106984807 60.35 45
downstream ENSMUSE00000258086 Chr9:106964330..106964414 TGAGACGCTAATCTGGTCTGAA Chr9:106964323..106964344 60.01 45.46
downstream ENSMUSE00000258072 Chr9:106958454..106958495 TTGGGATGTGCTCTGCTGTA Chr9:106958432..106958451 60.41 50
downstream ENSMUSE00000258051 Chr9:106957781..106957935 CCTTGGGCGCATTGTATCTA Chr9:106957893..106957912 60.98 50
downstream ENSMUSE00000350501 Chr9:106934607..106934688 AAAAGGGCACACATTCGTTC Chr9:106934589..106934608 59.98 45
downstream ENSMUSE00000257328 Chr9:106927652..106927712 CGGATCACATGGGCAACTAT Chr9:106927635..106927654 60.74 50
downstream ENSMUSE00000257980 Chr9:106926059..106926206 GCCATATGGTCGCCTGTAGT Chr9:106926120..106926139 59.99 55
downstream ENSMUSE00000257960 Chr9:106909122..106909210 TGGGTCCATTCACTCTCGTT Chr9:106909162..106909181 60.51 50
downstream ENSMUSE00000257943 Chr9:106907662..106907787 TGTCACCACGAAAAAGCTGA Chr9:106907730..106907749 60.43 45
downstream ENSMUSE00000257918 Chr9:106899225..106899349 CCCCCTCTTTCAAAGTCTCC Chr9:106899270..106899289 60.04 55
downstream ENSMUSE00000530193 Chr9:106897151..106897313 CTCCCCAGCGAGGACTATTA Chr9:106897204..106897223 59.29 55
downstream ENSMUSE00000257878 Chr9:106896386..106896492 GAGAGAACGCAAAGCCAAAG Chr9:106896426..106896445 60.13 50
downstream ENSMUSE00000257857 Chr9:106895726..106895897 GGGCAGCCATTGTAGTCTTC Chr9:106895796..106895815 59.7 55
downstream ENSMUSE00000257834 Chr9:106895298..106895395 TTTCAGCAGAGCAAGGAGGT Chr9:106895351..106895370 60.13 50
downstream ENSMUSE00000257809 Chr9:106893414..106893497 TGAAAAACCAAAAGGCCGTA Chr9:106893399..106893418 60.46 40
downstream ENSMUSE00000257780 Chr9:106891739..106891839 TGTCCATTACAGGTCGGAAG Chr9:106891757..106891776 58.57 50
downstream ENSMUSE00000257758 Chr9:106888325..106888406 GCTGAGCAGTCCATGTACCA Chr9:106888343..106888362 59.86 55
downstream ENSMUSE00000257730 Chr9:106880935..106881105 GGATTCGTGACTGCACAATG Chr9:106881041..106881060 60.12 50
downstream ENSMUSE00000257714 Chr9:106876085..106876277 CAGCTTCACCACATCCATTG Chr9:106876109..106876128 60.11 50
downstream ENSMUSE00000257700 Chr9:106872084..106872211 AGAGCTGGTCTTGACGATGG Chr9:106872065..106872084 60.41 55
downstream ENSMUSE00000257681 Chr9:106869408..106869554 GCCTCCTGAGCATGTGATTT Chr9:106869429..106869448 60.23 50
downstream ENSMUSE00000257662 Chr9:106867038..106867136 CACACATCTGACGGAGCAAT Chr9:106867069..106867088 59.71 50
downstream ENSMUSE00000257647 Chr9:106860738..106860832 CCAGTCTCGAGGGAAGACAC Chr9:106860742..106860761 59.83 60
downstream ENSMUSE00000258633 Chr9:106858409..106858484 TGCAGAGGACAGGTACTGGA Chr9:106858426..106858445 59.42 55
downstream ENSMUSE00000258606 Chr9:106857948..106858048 AAGGCTTGGCTGGTTTATGA Chr9:106857973..106857992 59.71 45
downstream ENSMUSE00000258579 Chr9:106857635..106857693 TCTGCCACATGCTGAACAGT Chr9:106857619..106857638 60.47 50
downstream ENSMUSE00000530190 Chr9:106854643..106854791 GGAAAGGACCAATCATTCCA Chr9:106854725..106854744 59.73 45
downstream ENSMUSE00000258534 Chr9:106846238..106846323 GCTGTCCAGCTTGTCAATCA Chr9:106846269..106846288 59.99 50
downstream ENSMUSE00000257608 Chr9:106843829..106843855 No primer for this exon
downstream ENSMUSE00000258500 Chr9:106843614..106843709 CGCGTGACTGAGGTAACAAA Chr9:106843619..106843638 59.9 50
downstream ENSMUSE00000530187 Chr9:106840449..106840509 AGTGCAGCCAACCTTCTTGT Chr9:106840439..106840458 59.91 50
downstream ENSMUSE00000258440 Chr9:106840232..106840325 GCCTGTAAGTGCATGTCACAA Chr9:106840224..106840244 59.78 47.62
downstream ENSMUSE00000258413 Chr9:106835306..106835454 GCAGCTCGCAGTAAAGAAGC Chr9:106835397..106835416 60.44 55
downstream ENSMUSE00000371236 Chr9:106834252..106834338 CCAGCTGAGGCTCTGGTAGT Chr9:106834236..106834255 59.62 60
downstream ENSMUSE00000401350 Chr9:106832351..106832455 AACCCGGAAGAACTCAGGTT Chr9:106832365..106832384 59.97 50
downstream ENSMUSE00000530184 Chr9:106816855..106816996 TGACCACGGCACACATATTC Chr9:106816949..106816968 60.4 50
downstream ENSMUSE00000258329 Chr9:106815438..106815604 CATACCGGAACTTCCTCACA Chr9:106815463..106815482 58.57 50
downstream ENSMUSE00000258314 Chr9:106815227..106815313 No primer for this exon
downstream ENSMUSE00000258296 Chr9:106814502..106814681 GATCAGAGCTCGCAGTTCCT Chr9:106814588..106814607 59.71 55
downstream ENSMUSE00000258273 Chr9:106813821..106813904 GGGAGATCTTCTCAGCGTCT Chr9:106813825..106813844 58.57 55
downstream ENSMUSE00000258242 Chr9:106813582..106813698 ACAGACTGGCCCTCATCATC Chr9:106813565..106813584 60.08 55
downstream ENSMUSE00000258216 Chr9:106810747..106810868 GCTATGGGATGCCAGAACAT Chr9:106810766..106810785 59.92 50
downstream ENSMUSE00000257556 Chr9:106809561..106809699 TGCATGTGGTGGTAGAGGTC Chr9:106809540..106809559 59.55 55
downstream ENSMUSE00000257534 Chr9:106808964..106809111 CTGGGACGAGGACAGAACAG Chr9:106809024..106809043 60.85 60
downstream ENSMUSE00000257518 Chr9:106804102..106804220 CGGGCATGTCGGTACTTATC Chr9:106804162..106804181 60.35 55
downstream ENSMUSE00000257502 Chr9:106803038..106803125 CAGGGTTTACAGGCTCCAAC Chr9:106803048..106803067 59.59 55
downstream ENSMUSE00000257479 Chr9:106799067..106799149 GTGGAAGGCGTCGAAGTGTA Chr9:106799096..106799115 61.24 55
downstream ENSMUSE00000510104 Chr9:106797711..106798234 CCGCAATAGCATACCCTCAT Chr9:106797814..106797833 59.94 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATAATCGCCTTGCAGCAC Chr9:107106734..107106754 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAATGATACGTGACTGGGAAAA Chr9:107106737..107106760 59.88 39.13 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039716