Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27701
Trapped Gene
Orc5l (ENSMUSG00000029012)
Vector Insertion
Chr 5: 22053835 - 22056009
Public Clones (ggtc) (ggtc)
Private Clones OST52685 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000266080 (Chr5:22056010..22056161 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTTTGCAGTCCCTGTTTGG Chr5:22056014..22056033 60.15 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000266080 (Chr5:22056010..22056161 -)
Downstram Exon
ENSMUSE00000184457 (Chr5:22053742..22053834 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTTTGCAGTCCCTGTTTGG Chr5:22056014..22056033 60.15 50 ATGGACGGAAAGCTGAAATG Chr5:22053787..22053806 60.07 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000266080 Chr5:22056010..22056161 ACTTTGCAGTCCCTGTTTGG Chr5:22056014..22056033 60.15 50

*** Putative Vector Insertion (Chr 5: 22053835 - 22056009) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000184457 Chr5:22053742..22053834 ATGGACGGAAAGCTGAAATG Chr5:22053787..22053806 60.07 45
downstream ENSMUSE00000184467 Chr5:22052216..22052416 TGTTCCAAAAGTAGCCTCGAA Chr5:22052336..22052356 59.87 42.86
downstream ENSMUSE00000266054 Chr5:22043340..22043414 CAGGCAAAAGATTTGCTTCC Chr5:22043341..22043360 59.82 45
downstream ENSMUSE00000266044 Chr5:22039581..22039692 TGGACGAAATTTTTCCCAAA Chr5:22039611..22039630 60.27 35
downstream ENSMUSE00000184477 Chr5:22034973..22035103 TCAGATCCCGACAGACAGTG Chr5:22034968..22034987 59.82 55
downstream ENSMUSE00000184474 Chr5:22032353..22032401 GGTTCACAGTATTTGGGGAAA Chr5:22032348..22032368 58.8 42.86
downstream ENSMUSE00000184470 Chr5:22032181..22032271 TTGCGAGTATCACGTTCACC Chr5:22032228..22032247 59.72 50
downstream ENSMUSE00000266009 Chr5:22030634..22030686 CTTTCAGTTGTCCTGGGTCTG Chr5:22030612..22030632 59.75 52.38
downstream ENSMUSE00000184472 Chr5:22029334..22029446 GAGGCAAGGTATGCAGCAAT Chr5:22029352..22029371 60.24 50
downstream ENSMUSE00000184458 Chr5:22028209..22028256 No primer for this exon
downstream ENSMUSE00000184463 Chr5:22022522..22022632 GGGCTTTGGTCCAAGAAGAT Chr5:22022581..22022600 60.44 50
downstream ENSMUSE00000265982 Chr5:22005794..22005906 GCATTTGTATTTTGGCCCATT Chr5:22005807..22005827 60.9 38.1
downstream ENSMUSE00000335364 Chr5:21992308..21993035 GTGGCGCTCTCAAAATTCAT Chr5:21992304..21992323 60.22 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACTTTGCAGTCCCTGTTTG Chr5:22056013..22056033 59.33 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029012