Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27708
Trapped Gene
Sema4b (ENSMUSG00000030539)
Vector Insertion
Chr 7: 87357846 - 87358148
Public Clones not available
Private Clones OST52269 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000200269 (Chr7:87357682..87357845 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGGCAAGACGCTGTATGTG Chr7:87357757..87357776 59.75 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000200269 (Chr7:87357682..87357845 +)
Downstram Exon
ENSMUSE00000200268 (Chr7:87358149..87358211 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGGCAAGACGCTGTATGTG Chr7:87357757..87357776 59.75 50 TCCTGTCAGCATCTGCACTC Chr7:87358179..87358198 60.15 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000507158 Chr7:87331727..87331877 TTCACGGGATACTCCAGGTC Chr7:87331757..87331776 59.93 55
upstream ENSMUSE00000475341 Chr7:87343405..87343656 TTCCACTTGAGCAACCTGAG Chr7:87343470..87343489 59.01 50
upstream ENSMUSE00000718257 Chr7:87343405..87343656 TTCCACTTGAGCAACCTGAG Chr7:87343470..87343489 59.01 50
upstream ENSMUSE00000200269 Chr7:87357682..87357845 ATGGCAAGACGCTGTATGTG Chr7:87357757..87357776 59.75 50

*** Putative Vector Insertion (Chr 7: 87357846 - 87358148) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000200268 Chr7:87358149..87358211 TCCTGTCAGCATCTGCACTC Chr7:87358179..87358198 60.15 55
downstream ENSMUSE00000200275 Chr7:87360510..87360608 CTGTTGAGTGGCAGGAGGAT Chr7:87360556..87360575 60.26 55
downstream ENSMUSE00000200283 Chr7:87361215..87361326 GGACTTGAAGTTGGGGTCAA Chr7:87361313..87361332 59.94 50
downstream ENSMUSE00000317215 Chr7:87361616..87361729 CGTTTCCCTGGAAGCTACTG Chr7:87361663..87361682 59.87 55
downstream ENSMUSE00000317206 Chr7:87361834..87361985 GGACACGATGGTGTTCTCAA Chr7:87361967..87361986 59.53 50
downstream ENSMUSE00000200282 Chr7:87363769..87363950 GGGTTCAGGGTGAAGACATC Chr7:87363899..87363918 59.36 55
downstream ENSMUSE00000200267 Chr7:87364072..87364222 AGGCCTTCTGCACATCATTC Chr7:87364139..87364158 60.23 50
downstream ENSMUSE00000200266 Chr7:87365007..87365217 GCAGGGACGAGTTGATCTTC Chr7:87365055..87365074 59.81 55
downstream ENSMUSE00000200270 Chr7:87365328..87365443 CTCTGGAGCTCAGGGTCACT Chr7:87365372..87365391 59.58 60
downstream ENSMUSE00000200274 Chr7:87365674..87365840 GAATGGGAGGAGGCATACAA Chr7:87365702..87365721 59.89 50
downstream ENSMUSE00000672952 Chr7:87365674..87366718 GCCAGATCAGGCTGGTAGAG Chr7:87365837..87365856 59.97 60
downstream ENSMUSE00000317179 Chr7:87368820..87368902 AAGAAACCGGGCCTTGTATG Chr7:87368898..87368917 61.22 50
downstream ENSMUSE00000406768 Chr7:87369482..87371410 GATTCTCAACTTCGGCTTGC Chr7:87370599..87370618 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000030539