Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27709
Trapped Gene
Tlcd1 (ENSMUSG00000019437)
Vector Insertion
Chr 11: 77993041 - 77993125
Public Clones not available
Private Clones OST52221 (lexicon)
Severity of mutation (?) Insertion after 38% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000676348 (Chr11:77993042..77993377 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000676348 (Chr11:77993042..77993377 +)
Downstram Exon
ENSMUSE00000389726 (Chr11:77993042..77993124 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000406527 Chr11:77992214..77992558 No primer for this exon
upstream ENSMUSE00000650136 Chr11:77992264..77992558 No primer for this exon
upstream ENSMUSE00000676345 Chr11:77992581..77992723 No primer for this exon
upstream ENSMUSE00000110072 Chr11:77992872..77992954 No primer for this exon

*** Putative Vector Insertion (Chr 11: 77993041 - 77993125) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000389726 Chr11:77993042..77993124 No primer for this exon
downstream ENSMUSE00000676348 Chr11:77993042..77993377 No primer for this exon
downstream ENSMUSE00000578279 Chr11:77993449..77993595 No primer for this exon
downstream ENSMUSE00000578281 Chr11:77993449..77993976 No primer for this exon
downstream ENSMUSE00000578278 Chr11:77993677..77993832 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAAACTCGTAATCGCCTTGC Chr11:77993084..77993104 60.77 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCACGACACAGTGGACATT Chr11:77993052..77993072 60.01 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019437