Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27711
Trapped Gene
Trdn (ENSMUSG00000019787)
Vector Insertion
Chr 10: 32920064 - 32953660
Public Clones not available
Private Clones OST52162 (lexicon)
Severity of mutation (?) Insertion after 86% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000576741 (Chr10:32919969..32920063 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000576741 (Chr10:32919969..32920063 +)
Downstram Exon
ENSMUSE00000359248 (Chr10:32953661..32953791 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000519678 Chr10:32803367..32803551 No primer for this exon
upstream ENSMUSE00000408141 Chr10:32858880..32859089 No primer for this exon
upstream ENSMUSE00000098047 Chr10:32876819..32876980 No primer for this exon
upstream ENSMUSE00000098045 Chr10:32878052..32878084 No primer for this exon
upstream ENSMUSE00000098048 Chr10:32895575..32895634 No primer for this exon
upstream ENSMUSE00000318089 Chr10:32903760..32903822 No primer for this exon
upstream ENSMUSE00000318082 Chr10:32906447..32906506 No primer for this exon
upstream ENSMUSE00000318075 Chr10:32915755..32915931 No primer for this exon
upstream ENSMUSE00000576741 Chr10:32919969..32920063 No primer for this exon

*** Putative Vector Insertion (Chr 10: 32920064 - 32953660) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000359248 Chr10:32953661..32953791 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCAGGGTGGTAAATGACTT Chr10:32935047..32935067 58.76 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTAGTCCTATGGGCAGCGTGA Chr10:32935099..32935120 62.59 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019787