Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27716
Trapped Gene
Osbpl10 (ENSMUSG00000040875)
Vector Insertion
Chr 9: 115116782 - 115125666
Public Clones not available
Private Clones OST51935 (lexicon)
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000328911 (Chr9:115116632..115116781 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCATGGAGGATCAGCGTAGT Chr9:115116711..115116730 60.1 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000328911 (Chr9:115116632..115116781 +)
Downstram Exon
ENSMUSE00000329178 (Chr9:115125667..115126147 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCATGGAGGATCAGCGTAGT Chr9:115116711..115116730 60.1 55 CGTGGAAGGCCGTAAGATAA Chr9:115125826..115125845 60.09 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000688999 Chr9:114976397..114976443 GCCAAATACCACATGGAGATG Chr9:114976414..114976434 60.21 47.62
upstream ENSMUSE00000328943 Chr9:115018518..115018709 CCGAAGAGCCAAGAGTCAGT Chr9:115018661..115018680 59.6 55
upstream ENSMUSE00000329233 Chr9:115076200..115076410 AGCAGAAGAACCTCGTGCAT Chr9:115076222..115076241 60.02 50
upstream ENSMUSE00000328927 Chr9:115085046..115085200 TGGGCGATTCTACCAAACTC Chr9:115085144..115085163 60.07 50
upstream ENSMUSE00000328911 Chr9:115116632..115116781 CCATGGAGGATCAGCGTAGT Chr9:115116711..115116730 60.1 55

*** Putative Vector Insertion (Chr 9: 115116782 - 115125666) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000329178 Chr9:115125667..115126147 CGTGGAAGGCCGTAAGATAA Chr9:115125826..115125845 60.09 50
downstream ENSMUSE00000329147 Chr9:115132711..115132897 GTAGAAGGGCTTCGTGTGGA Chr9:115132883..115132902 60.26 55
downstream ENSMUSE00000329123 Chr9:115135799..115135981 GTGAACTCCAAGGTGCCATT Chr9:115135885..115135904 59.97 50
downstream ENSMUSE00000329099 Chr9:115138978..115139131 AAGCCTCAGGTAGTGGGTGA Chr9:115139017..115139036 59.72 55
downstream ENSMUSE00000633778 Chr9:115141230..115141341 GCCTATTACGGGAAGCACTG Chr9:115141309..115141328 59.73 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCTGACCAAGGTAGGCTGA Chr9:115116772..115116792 59.72 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCTGACCAAGGTAGGCTGA Chr9:115116772..115116792 59.72 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040875