Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27726
Trapped Gene
Atp2c1 (ENSMUSG00000032570)
Vector Insertion
Chr 9: 105362099 - 105363346
Public Clones not available
Private Clones OST51424 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000220944 (Chr9:105363347..105363408 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACTTGTGCCACCAGAATGC Chr9:105363352..105363371 61.11 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000220944 (Chr9:105363347..105363408 -)
Downstram Exon
ENSMUSE00000265230 (Chr9:105361990..105362098 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACTTGTGCCACCAGAATGC Chr9:105363352..105363371 61.11 50 AGTCTCGGGCAAGTGTATGC Chr9:105362036..105362055 60.28 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000634671 Chr9:105423370..105423477 TCCGTCCGGATTTTCTTACTT Chr9:105423440..105423460 59.95 42.86
upstream ENSMUSE00000428484 Chr9:105397223..105397429 CCGTCCTGCTCCTTCTCCTC Chr9:105397299..105397318 63.68 65
upstream ENSMUSE00000428466 Chr9:105396745..105396927 GATTCCGGGGTCTTCTCTTC Chr9:105396841..105396860 60.01 55
upstream ENSMUSE00000692237 Chr9:105372503..105372508 No primer for this exon
upstream ENSMUSE00000634670 Chr9:105372367..105372477 TTGCACGATTTCAAAAGATCC Chr9:105372456..105372476 60.07 38.1
upstream ENSMUSE00000220948 Chr9:105370031..105370147 TAGTCATAGGCGAGCCTTCC Chr9:105370093..105370112 59.43 55
upstream ENSMUSE00000220947 Chr9:105368913..105369002 TTAATGCGCCAGTTTGATGA Chr9:105368932..105368951 60.22 40
upstream ENSMUSE00000220950 Chr9:105366956..105366991 TCACTGTGGCCTTTGTTCAG Chr9:105366956..105366975 59.87 50
upstream ENSMUSE00000220944 Chr9:105363347..105363408 AACTTGTGCCACCAGAATGC Chr9:105363352..105363371 61.11 50

*** Putative Vector Insertion (Chr 9: 105362099 - 105363346) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000265230 Chr9:105361990..105362098 AGTCTCGGGCAAGTGTATGC Chr9:105362036..105362055 60.28 55
downstream ENSMUSE00000692275 Chr9:105355864..105356016 CCCATGAAGGCGATGTTACT Chr9:105355870..105355889 59.96 50
downstream ENSMUSE00000634667 Chr9:105355105..105355173 TCTTCTGCCTGCATCATCTT Chr9:105355084..105355103 58.54 45
downstream ENSMUSE00000634666 Chr9:105354134..105354209 CTTGCCTAAGAGGTCCATGC Chr9:105354143..105354162 59.84 55
downstream ENSMUSE00000634665 Chr9:105351152..105351218 TCCTAGTAACCAGCCAACCAA Chr9:105351165..105351185 59.62 47.62
downstream ENSMUSE00000634664 Chr9:105348382..105348506 CACCAAGGGCTAGAGTCACC Chr9:105348420..105348439 59.72 60
downstream ENSMUSE00000634663 Chr9:105347548..105347645 CTCGTTCTTCGTCAGGGTTC Chr9:105347571..105347590 59.84 55
downstream ENSMUSE00000634662 Chr9:105345276..105345371 No primer for this exon
downstream ENSMUSE00000634661 Chr9:105345096..105345185 CAGCATCATTGCACACACAG Chr9:105345139..105345158 59.89 50
downstream ENSMUSE00000634660 Chr9:105341671..105341775 AACAGCCATCCACTTCTGCT Chr9:105341673..105341692 59.87 50
downstream ENSMUSE00000692236 Chr9:105338884..105338907 AGCCAACAGTATCCACACCA Chr9:105338865..105338884 59.01 50
downstream ENSMUSE00000634659 Chr9:105337382..105337538 CCTGCTCATAAGCACCCTTC Chr9:105337474..105337493 59.84 55
downstream ENSMUSE00000634658 Chr9:105334984..105335154 TCCTGAGGCAATGAGTGTTG Chr9:105335014..105335033 59.83 50
downstream ENSMUSE00000634657 Chr9:105333825..105333922 TGCACCTCCATTGTATCGAC Chr9:105333828..105333847 59.53 50
downstream ENSMUSE00000634656 Chr9:105326500..105326550 ATCTTGTGTCTTGGGCTTGC Chr9:105326491..105326510 60.26 50
downstream ENSMUSE00000634655 Chr9:105325273..105325439 TACAACTGCCCCGTTCTTCT Chr9:105325391..105325410 59.73 50
downstream ENSMUSE00000634654 Chr9:105323904..105323972 No primer for this exon
downstream ENSMUSE00000634653 Chr9:105322512..105322628 GCATTGCATTGAGAGGGTTA Chr9:105322536..105322555 58.72 45
downstream ENSMUSE00000634651 Chr9:105320874..105321021 GCGGTTTTCGAATGACATCT Chr9:105320956..105320975 60.08 45
downstream ENSMUSE00000634650 Chr9:105320380..105320475 CTCGGGGTGTTATCACATTG Chr9:105320426..105320445 58.85 50
downstream ENSMUSE00000634649 Chr9:105316964..105317105 CAGGCTCTCGGTTTGAAAAA Chr9:105316952..105316971 60.36 45
downstream ENSMUSE00000428230 Chr9:105313693..105315519 AAGGAAGCACGGTAGCTGAA Chr9:105314875..105314894 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACTTGTGCCACCAGAATGC Chr9:105363350..105363370 61.11 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACTTGTGCCACCAGAATGC Chr9:105363350..105363370 61.11 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032570