Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27727
Trapped Gene
Tex11 (ENSMUSG00000009670)
Vector Insertion
Chr X: 98045717 - 98047164
Public Clones not available
Private Clones OST51395 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000208004 (ChrX:98047165..98047314 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000208004 (ChrX:98047165..98047314 -)
Downstram Exon
ENSMUSE00000208024 (ChrX:98045608..98045716 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000486971 ChrX:98254852..98254978 No primer for this exon
upstream ENSMUSE00000696777 ChrX:98254852..98255006 No primer for this exon
upstream ENSMUSE00000289411 ChrX:98254695..98254756 No primer for this exon
upstream ENSMUSE00000708404 ChrX:98254695..98254756 No primer for this exon
upstream ENSMUSE00000208017 ChrX:98245798..98245919 No primer for this exon
upstream ENSMUSE00000208036 ChrX:98238780..98238864 No primer for this exon
upstream ENSMUSE00000208015 ChrX:98234386..98234465 No primer for this exon
upstream ENSMUSE00000208002 ChrX:98228040..98228120 No primer for this exon
upstream ENSMUSE00000289368 ChrX:98227837..98227956 No primer for this exon
upstream ENSMUSE00000289359 ChrX:98210883..98210963 No primer for this exon
upstream ENSMUSE00000289349 ChrX:98203042..98203127 No primer for this exon
upstream ENSMUSE00000289342 ChrX:98181032..98181086 No primer for this exon
upstream ENSMUSE00000289332 ChrX:98172963..98173058 No primer for this exon
upstream ENSMUSE00000289321 ChrX:98170519..98170600 No primer for this exon
upstream ENSMUSE00000289312 ChrX:98167433..98167511 No primer for this exon
upstream ENSMUSE00000289305 ChrX:98150039..98150190 No primer for this exon
upstream ENSMUSE00000289297 ChrX:98146904..98146989 No primer for this exon
upstream ENSMUSE00000289291 ChrX:98141995..98142132 No primer for this exon
upstream ENSMUSE00000437827 ChrX:98128727..98128829 No primer for this exon
upstream ENSMUSE00000437823 ChrX:98111865..98111989 No primer for this exon
upstream ENSMUSE00000437817 ChrX:98101458..98101543 No primer for this exon
upstream ENSMUSE00000437811 ChrX:98099097..98099153 No primer for this exon
upstream ENSMUSE00000437807 ChrX:98079701..98079741 No primer for this exon
upstream ENSMUSE00000437803 ChrX:98078262..98078348 No primer for this exon
upstream ENSMUSE00000437796 ChrX:98077583..98077653 No primer for this exon
upstream ENSMUSE00000696776 ChrX:98075318..98075432 No primer for this exon
upstream ENSMUSE00000500929 ChrX:98075316..98075432 No primer for this exon
upstream ENSMUSE00000696773 ChrX:98073511..98073564 No primer for this exon
upstream ENSMUSE00000437558 ChrX:98071875..98071947 No primer for this exon
upstream ENSMUSE00000696775 ChrX:98071875..98071949 No primer for this exon
upstream ENSMUSE00000208004 ChrX:98047165..98047314 No primer for this exon

*** Putative Vector Insertion (Chr X: 98045717 - 98047164) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000208024 ChrX:98045608..98045716 No primer for this exon
downstream ENSMUSE00000208020 ChrX:98044388..98044508 No primer for this exon
downstream ENSMUSE00000208034 ChrX:98035040..98035204 No primer for this exon
downstream ENSMUSE00000289200 ChrX:98033987..98034399 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACA ChrX:98047095..98047115 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCCTACGTGACTGGGAAAA ChrX:98047099..98047119 59.73 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000009670