Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2773
Trapped Gene
Dyrk3 (ENSMUSG00000016526)
Vector Insertion
Chr 1: 133026823 - 133032836
Public Clones XR0158 (sanger) AK0018 (sanger) CMHD-GT_260H2-3 (cmhd)
Private Clones OST132133 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000158951 (Chr1:133032837..133032948 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000158951 (Chr1:133032837..133032948 -)
Downstram Exon
ENSMUSE00000400459 (Chr1:133025019..133026822 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000539859 Chr1:133034657..133034811 No primer for this exon
upstream ENSMUSE00000158951 Chr1:133032837..133032948 No primer for this exon

*** Putative Vector Insertion (Chr 1: 133026823 - 133032836) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000400459 Chr1:133025019..133026822 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACAT Chr1:133032766..133032787 60.62 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAGGAAAATGGGAAAGAATGT Chr1:133032789..133032811 59.81 36.36 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000016526