Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27732
Trapped Gene
She (ENSMUSG00000046280)
Vector Insertion
Chr 3: 89656409 - 89658452
Public Clones CMHD-GT_432H5-3 (cmhd)
Private Clones OST51191 (lexicon)
Severity of mutation (?) Insertion after 82% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000393714 (Chr3:89656289..89656408 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTCCGGAACAGTGAGTCAG Chr3:89656361..89656380 60.71 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000393714 (Chr3:89656289..89656408 +)
Downstram Exon
ENSMUSE00000348017 (Chr3:89658453..89662758 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTCCGGAACAGTGAGTCAG Chr3:89656361..89656380 60.71 60 AAGGCACCTGCATTACAACC Chr3:89662639..89662658 60 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000403332 Chr3:89635292..89636025 AGCTGGACAAGGCCAAGATA Chr3:89635988..89636007 59.84 50
upstream ENSMUSE00000672999 Chr3:89635426..89635487 CTGGGCCTCCTCACTCTTCT Chr3:89635467..89635486 60.92 60
upstream ENSMUSE00000672998 Chr3:89635944..89636025 AGCTGGACAAGGCCAAGATA Chr3:89635988..89636007 59.84 50
upstream ENSMUSE00000360671 Chr3:89638066..89638192 GGTGAGAACGACGGCTACAT Chr3:89638141..89638160 60.14 55
upstream ENSMUSE00000385627 Chr3:89653290..89653595 AGCCGCCACAACTCTATGAC Chr3:89653422..89653441 60.28 55
upstream ENSMUSE00000350411 Chr3:89655531..89655672 TTGAGGGATCTGATCGACCT Chr3:89655537..89655556 59.61 50
upstream ENSMUSE00000393714 Chr3:89656289..89656408 GGTCCGGAACAGTGAGTCAG Chr3:89656361..89656380 60.71 60

*** Putative Vector Insertion (Chr 3: 89656409 - 89658452) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000348017 Chr3:89658453..89662758 AAGGCACCTGCATTACAACC Chr3:89662639..89662658 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGTGAGTCAGGGAACAGCA Chr3:89656371..89656391 60.02 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGTGAGTCAGGGAACAGCA Chr3:89656371..89656391 60.02 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000046280