Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27737
Trapped Gene
Sgtb (ENSMUSG00000042743)
Vector Insertion
Chr 13: 104901270 - 104908403
Public Clones not available
Private Clones OST51046 (lexicon) OST51045 (lexicon) OST51034 (lexicon) OST51033 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000313734 (Chr13:104901150..104901269 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TATTCGTTTCTTGCGGGAAC Chr13:104901202..104901221 60.07 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000313734 (Chr13:104901150..104901269 +)
Downstram Exon
ENSMUSE00000313725 (Chr13:104908404..104908507 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TATTCGTTTCTTGCGGGAAC Chr13:104901202..104901221 60.07 45 AAACGGTCTCCAAACACTGG Chr13:104908433..104908452 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000313739 Chr13:104899870..104900049 TCATCTCGTGTCCTCTCGTG Chr13:104900030..104900049 59.98 55
upstream ENSMUSE00000313734 Chr13:104901150..104901269 TATTCGTTTCTTGCGGGAAC Chr13:104901202..104901221 60.07 45

*** Putative Vector Insertion (Chr 13: 104901270 - 104908403) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000313725 Chr13:104908404..104908507 AAACGGTCTCCAAACACTGG Chr13:104908433..104908452 60.01 50
downstream ENSMUSE00000313716 Chr13:104911547..104911616 No primer for this exon
downstream ENSMUSE00000313711 Chr13:104914270..104914369 CCGCAGCGTAATTTTCTTCT Chr13:104914308..104914327 59.5 45
downstream ENSMUSE00000313705 Chr13:104919309..104919413 CTTCCGTAGGCCTTGCTGTA Chr13:104919410..104919429 60.4 55
downstream ENSMUSE00000313695 Chr13:104922017..104922155 CCAGTGCCTTCTGGTAGCTT Chr13:104922081..104922100 59.5 55
downstream ENSMUSE00000569066 Chr13:104922246..104922308 GGCCGGGTTATTTATCAAGC Chr13:104922299..104922318 60.64 50
downstream ENSMUSE00000313681 Chr13:104924684..104924721 GCTGCTGAACTTGAGGGTTC Chr13:104924723..104924742 60 55
downstream ENSMUSE00000313672 Chr13:104924920..104925003 CAGGTCTGTTAGGCCTCCAA Chr13:104924989..104925008 60.25 55
downstream ENSMUSE00000334328 Chr13:104929820..104931519 TGCCACTCTCGATAGACACG Chr13:104930418..104930437 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATAGTGTTGGGAGGGCAGT Chr13:104904264..104904284 59.99 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGCACCTATTGTTTGTGTCC Chr13:104904273..104904294 58.97 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042743