Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27748
Trapped Gene
BC011426 (ENSMUSG00000003198)
Vector Insertion
Chr 17: 56031610 - 56035243
Public Clones not available
Private Clones OST50553 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000694377 (Chr17:56031516..56031609 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000694377 (Chr17:56031516..56031609 +)
Downstram Exon
ENSMUSE00000541903 (Chr17:56035244..56035370 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000694377 Chr17:56031516..56031609 No primer for this exon

*** Putative Vector Insertion (Chr 17: 56031610 - 56035243) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000541903 Chr17:56035244..56035370 No primer for this exon
downstream ENSMUSE00000541902 Chr17:56035564..56035624 No primer for this exon
downstream ENSMUSE00000541901 Chr17:56036579..56038355 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCGGGAGTCTGTGTTAATCG Chr17:56031647..56031667 60.66 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGTCGTGACTGGGAAAACC Chr17:56031657..56031677 60.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000003198