Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27750
Trapped Gene
Sdhd (ENSMUSG00000000171)
Vector Insertion
Chr 9: 50407011 - 50408652
Public Clones not available
Private Clones OST50517 (lexicon)
Severity of mutation (?) Insertion after 36% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000216226 (Chr9:50408653..50408769 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000216226 (Chr9:50408653..50408769 -)
Downstram Exon
ENSMUSE00000216224 (Chr9:50406866..50407010 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000285370 Chr9:50411843..50411922 No primer for this exon
upstream ENSMUSE00000216226 Chr9:50408653..50408769 No primer for this exon

*** Putative Vector Insertion (Chr 9: 50407011 - 50408652) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000216224 Chr9:50406866..50407010 No primer for this exon
downstream ENSMUSE00000382814 Chr9:50404451..50405355 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGCACATTCACCTGTCACC Chr9:50408662..50408682 60.16 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGCACATTCACCTGTCACC Chr9:50408662..50408682 60.16 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000171