Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27751
Trapped Gene
BC107230 (ENSMUSG00000047257)
Vector Insertion
Chr 9: 110738597 - 110740924
Public Clones IST13140G9 (tigm) IST12858H4BBF1 (tigm)
Private Clones OST50503 (lexicon)
Severity of mutation (?) Insertion after 14% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000405817 (Chr9:110738570..110738596 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000405817 (Chr9:110738570..110738596 +)
Downstram Exon
ENSMUSE00000370872 (Chr9:110740925..110741072 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon ACCCAGCTTCGATCAATGAG Chr9:110741048..110741067 60.22 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000367859 Chr9:110737092..110737243 GAGGCGCTGGATCCTAATCT Chr9:110737182..110737201 60.7 55
upstream ENSMUSE00000405817 Chr9:110738570..110738596 No primer for this exon

*** Putative Vector Insertion (Chr 9: 110738597 - 110740924) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000370872 Chr9:110740925..110741072 ACCCAGCTTCGATCAATGAG Chr9:110741048..110741067 60.22 50
downstream ENSMUSE00000220143 Chr9:110741526..110741800 GCAATGTCGCTTCTGATGAA Chr9:110741666..110741685 59.96 45
downstream ENSMUSE00000346440 Chr9:110742891..110743054 CCTCCCCATAATTGGTGGTA Chr9:110743046..110743065 59.5 50
downstream ENSMUSE00000384301 Chr9:110743349..110743813 TCTGCCATCGATCTCACAAG Chr9:110743393..110743412 59.94 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr9:110738647..110738667 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAAAAACGTGACTGGGAAA Chr9:110738641..110738661 59.95 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047257