Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27759
Trapped Gene
Nmd3 (ENSMUSG00000027787)
Vector Insertion
Chr 3: 69534456 - 69535486
Public Clones not available
Private Clones OST50124 (lexicon)
Severity of mutation (?) Insertion after 32% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000173001 (Chr3:69534327..69534455 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTGATCCAAGTCAGGCAAA Chr3:69534434..69534453 60.24 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000173001 (Chr3:69534327..69534455 +)
Downstram Exon
ENSMUSE00000172991 (Chr3:69535487..69535577 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTGATCCAAGTCAGGCAAA Chr3:69534434..69534453 60.24 45 TGAATCTCCTTGATACGCAGTG Chr3:69535576..69535597 60.27 45.46

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000260146 Chr3:69526009..69526044 GGTGTATTTCGCCCTGTCAC Chr3:69526015..69526034 60.38 55
upstream ENSMUSE00000260140 Chr3:69526331..69526388 GCAGAGTCCATTGAGCACAG Chr3:69526357..69526376 59.58 55
upstream ENSMUSE00000173004 Chr3:69528179..69528313 TTGTGTGGCCTGTTTACGAA Chr3:69528227..69528246 60.15 45
upstream ENSMUSE00000172997 Chr3:69530283..69530379 CAGCATCATGGGTACAGTGTG Chr3:69530297..69530317 60.04 52.38
upstream ENSMUSE00000172993 Chr3:69533260..69533340 AGCCCCATTCCAAGAGACTT Chr3:69533294..69533313 60.07 50
upstream ENSMUSE00000173001 Chr3:69534327..69534455 TGTGATCCAAGTCAGGCAAA Chr3:69534434..69534453 60.24 45

*** Putative Vector Insertion (Chr 3: 69534456 - 69535486) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000172991 Chr3:69535487..69535577 TGAATCTCCTTGATACGCAGTG Chr3:69535576..69535597 60.27 45.46
downstream ENSMUSE00000172995 Chr3:69538968..69539046 CCCTGAAGAAACTCCACCAT Chr3:69539034..69539053 58.99 50
downstream ENSMUSE00000173000 Chr3:69539915..69540011 No primer for this exon
downstream ENSMUSE00000172996 Chr3:69543842..69543959 TGGGTCTATGAGGTGGATGG Chr3:69543949..69543968 60.74 55
downstream ENSMUSE00000172994 Chr3:69545431..69545576 TTCGCTTCAGATCTCGGACT Chr3:69545550..69545569 60.1 50
downstream ENSMUSE00000172992 Chr3:69547438..69547550 No primer for this exon
downstream ENSMUSE00000260075 Chr3:69549135..69549207 No primer for this exon
downstream ENSMUSE00000260067 Chr3:69550651..69550757 GGTGCGGTCATAGCTCTTCT Chr3:69550683..69550702 59.46 55
downstream ENSMUSE00000172998 Chr3:69552220..69552290 No primer for this exon
downstream ENSMUSE00000382199 Chr3:69552694..69552964 TGATGCACCTTCTTCACCAG Chr3:69552815..69552834 59.83 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGCTGTGATCCAAGTCAGG Chr3:69534431..69534451 60.26 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGCTGTGATCCAAGTCAGG Chr3:69534431..69534451 60.26 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027787