Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27761
Trapped Gene
Tnfrsf21 (ENSMUSG00000023915)
Vector Insertion
Chr 17: 43154042 - 43174543
Public Clones IST11107E2 (tigm) IST11107E2 (tigm)
Private Clones OST50095 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000435335 (Chr17:43153504..43154041 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTTGATAGTGGCTGGAAGC Chr17:43153574..43153593 59.99 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000435335 (Chr17:43153504..43154041 +)
Downstram Exon
ENSMUSE00000136327 (Chr17:43174544..43175195 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTTGATAGTGGCTGGAAGC Chr17:43153574..43153593 59.99 55 GATGCACTCTCGGTCAGTCA Chr17:43174846..43174865 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000435335 Chr17:43153504..43154041 GCTTGATAGTGGCTGGAAGC Chr17:43153574..43153593 59.99 55

*** Putative Vector Insertion (Chr 17: 43154042 - 43174543) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000136327 Chr17:43174544..43175195 GATGCACTCTCGGTCAGTCA Chr17:43174846..43174865 59.99 55
downstream ENSMUSE00000136325 Chr17:43176644..43177138 TCCTGGAGCTCTTTCGGATA Chr17:43177024..43177043 59.91 50
downstream ENSMUSE00000490105 Chr17:43201917..43202182 CATCAGCCCACGAATCTTCT Chr17:43202170..43202189 60.22 50
downstream ENSMUSE00000136326 Chr17:43222285..43222513 TCTGACTCGTCCACGAAGAA Chr17:43222442..43222461 59.54 50
downstream ENSMUSE00000402555 Chr17:43224692..43226137 AACTCACCGGCCATACACTC Chr17:43225042..43225061 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TACACGTTCCAGGCCAAAGT Chr17:43160002..43160022 60.55 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTTACTGCAATGCTCGTGA Chr17:43160078..43160098 60.17 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023915