Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27763
Trapped Gene
Golga7 (ENSMUSG00000015341)
Vector Insertion
Chr 8: 24356437 - 24360720
Public Clones not available
Private Clones OST50083 (lexicon)
Severity of mutation (?) Insertion after 64% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000472308 (Chr8:24360721..24360873 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000472308 (Chr8:24360721..24360873 -)
Downstram Exon
ENSMUSE00000467226 (Chr8:24356335..24356436 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000495478 Chr8:24367492..24367546 No primer for this exon
upstream ENSMUSE00000380755 Chr8:24367146..24367278 No primer for this exon
upstream ENSMUSE00000718057 Chr8:24367146..24367493 No primer for this exon
upstream ENSMUSE00000472308 Chr8:24360721..24360873 No primer for this exon

*** Putative Vector Insertion (Chr 8: 24356437 - 24360720) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000467226 Chr8:24356335..24356436 No primer for this exon
downstream ENSMUSE00000449465 Chr8:24355203..24355265 No primer for this exon
downstream ENSMUSE00000344204 Chr8:24351825..24353103 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATGCTCACATTGCTTCAGG Chr8:24360739..24360759 59.4 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAAGAAGACGTGACTGGGAAA Chr8:24360656..24360677 58.83 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000015341