Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2777
Trapped Gene
Arid1b (ENSMUSG00000069729)
Vector Insertion
Chr 17: 5097733 - 5126913
Public Clones (sanger) AJ0568 (sanger)
Private Clones OST462137 (lexicon) OST461639 (lexicon) OST395513 (lexicon) OST379620 (lexicon)
OST278300 (lexicon) OST26638 (lexicon) OST19684 (lexicon) OST17490 (lexicon)
OST13190 (lexicon)
Severity of mutation (?) Insertion after 28% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000658488 (Chr17:5097574..5097732 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGCAAGCTGTGAGTGGCTA Chr17:5097592..5097611 60.35 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000658488 (Chr17:5097574..5097732 +)
Downstram Exon
ENSMUSE00000707557 (Chr17:5126914..5127024 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGCAAGCTGTGAGTGGCTA Chr17:5097592..5097611 60.35 55 TCGATGGTCTTTCCTGTTGA Chr17:5127019..5127038 59.22 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000704213 Chr17:4994939..4996492 GCAGCAGCTAAACCAGTTCC Chr17:4995250..4995269 60.02 55
upstream ENSMUSE00000704207 Chr17:4996421..4996492 No primer for this exon
upstream ENSMUSE00000704206 Chr17:4996422..4996492 No primer for this exon
upstream ENSMUSE00000704212 Chr17:5040580..5040774 ATGGGTACTCACCCCCACTC Chr17:5040628..5040647 61.03 60
upstream ENSMUSE00000658488 Chr17:5097574..5097732 CAGCAAGCTGTGAGTGGCTA Chr17:5097592..5097611 60.35 55

*** Putative Vector Insertion (Chr 17: 5097733 - 5126913) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000707557 Chr17:5126914..5127024 TCGATGGTCTTTCCTGTTGA Chr17:5127019..5127038 59.22 45
downstream ENSMUSE00000614511 Chr17:5242828..5243071 CTCCCTGGCTGCTTGTAGAC Chr17:5242924..5242943 60.01 60
downstream ENSMUSE00000614510 Chr17:5264032..5264121 GGGAACTGGATTCTGACTGG Chr17:5264085..5264104 59.51 55
downstream ENSMUSE00000614509 Chr17:5279203..5279382 TGCTGAGGTCCGTACTGAGA Chr17:5279260..5279279 59.57 55
downstream ENSMUSE00000704202 Chr17:5279215..5279382 TGCTGAGGTCCGTACTGAGA Chr17:5279260..5279279 59.57 55
downstream ENSMUSE00000614508 Chr17:5290956..5291283 TGGGGTTCTGGAGTAGTTGC Chr17:5290978..5290997 60.11 55
downstream ENSMUSE00000577466 Chr17:5305749..5305894 TCATCAGGCTGGAGTTGTTG Chr17:5305843..5305862 59.83 50
downstream ENSMUSE00000614507 Chr17:5311835..5311944 GGGACACGCCTTCTTCTTTA Chr17:5311927..5311946 59.31 50
downstream ENSMUSE00000614506 Chr17:5313874..5314032 GAAATGCCCTGAGAGCCATA Chr17:5313902..5313921 60.18 50
downstream ENSMUSE00000614505 Chr17:5318641..5318850 GCCAAACCTCCAATCTCCTT Chr17:5318849..5318868 60.44 50
downstream ENSMUSE00000614504 Chr17:5321273..5321477 AGCTCACGCCACTTCTTGTT Chr17:5321304..5321323 60.06 50
downstream ENSMUSE00000704201 Chr17:5321273..5321476 AGCTCACGCCACTTCTTGTT Chr17:5321304..5321323 60.06 50
downstream ENSMUSE00000658486 Chr17:5327276..5327414 GCTTTGCATGGGAGTCATCT Chr17:5327412..5327431 60.23 50
downstream ENSMUSE00000658485 Chr17:5327649..5327821 GCGTTTGGAGTCATGGAGTT Chr17:5327735..5327754 60.12 50
downstream ENSMUSE00000658484 Chr17:5332487..5332637 TGGTTCCATAGGGAAACTGC Chr17:5332627..5332646 59.93 50
downstream ENSMUSE00000658483 Chr17:5334964..5335060 CTGCTGTCCGTAAGCCTCAT Chr17:5334988..5335007 60.42 55
downstream ENSMUSE00000658482 Chr17:5336525..5337308 CGTGATTGATCCTCTGCTCA Chr17:5336942..5336961 59.94 50
downstream ENSMUSE00000658481 Chr17:5339216..5339346 CAGACCCGATTTAAGGGACA Chr17:5339265..5339284 59.93 50
downstream ENSMUSE00000658478 Chr17:5341363..5347656 AGCTCTCAGGGCAAACGATA Chr17:5346126..5346145 59.98 50
downstream ENSMUSE00000658480 Chr17:5341363..5343505 TGGGCAAGGTTCGATAAAAG Chr17:5342759..5342778 60.07 45
downstream ENSMUSE00000556742 Chr17:5341586..5343261 TGGGCAAGGTTCGATAAAAG Chr17:5342759..5342778 60.07 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGAGGAGTGTGACAGCACAT Chr17:5103705..5103725 59.9 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGAGGAGTGTGACAGCACAT Chr17:5103705..5103725 59.9 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000069729