Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27774
Trapped Gene
Cabin1 (ENSMUSG00000020196)
Vector Insertion
Chr 10: 75110967 - 75115619
Public Clones (sanger) (sanger) (sanger) (ggtc) (ggtc) (ggtc)
(ggtc) IST12344B6 (tigm) IST12344B6 (tigm) IST11829C6 (tigm) IST12420G4 (tigm)
IST10884A8 (tigm) IST12043B3 (tigm) IST11703G10 (tigm) IST11552A1 (tigm)
IST14281F7 (tigm) IST14881G12 (tigm) IST11703G10 (tigm) IST11841A3 (tigm)
IST13040A1 (tigm) IST11829C6 (tigm)
Private Clones OST49660 (lexicon)
Severity of mutation (?) Insertion after 92% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000611578 (Chr10:75115620..75115887 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000611578 (Chr10:75115620..75115887 -)
Downstram Exon
ENSMUSE00000611577 (Chr10:75110802..75110966 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000575579 Chr10:75226770..75227102 No primer for this exon
upstream ENSMUSE00000611584 Chr10:75218114..75218245 No primer for this exon
upstream ENSMUSE00000575571 Chr10:75217557..75217649 No primer for this exon
upstream ENSMUSE00000575570 Chr10:75216996..75217109 No primer for this exon
upstream ENSMUSE00000575569 Chr10:75216122..75216256 No primer for this exon
upstream ENSMUSE00000575568 Chr10:75214181..75214361 No primer for this exon
upstream ENSMUSE00000575567 Chr10:75212789..75212918 No primer for this exon
upstream ENSMUSE00000575566 Chr10:75210571..75210720 No primer for this exon
upstream ENSMUSE00000575565 Chr10:75209233..75209519 No primer for this exon
upstream ENSMUSE00000575564 Chr10:75207974..75208142 No primer for this exon
upstream ENSMUSE00000575563 Chr10:75205947..75206083 No primer for this exon
upstream ENSMUSE00000575562 Chr10:75204990..75205207 No primer for this exon
upstream ENSMUSE00000575561 Chr10:75202765..75202843 No primer for this exon
upstream ENSMUSE00000575560 Chr10:75202071..75202258 No primer for this exon
upstream ENSMUSE00000575559 Chr10:75200956..75201108 No primer for this exon
upstream ENSMUSE00000575558 Chr10:75200066..75200260 No primer for this exon
upstream ENSMUSE00000575557 Chr10:75197711..75197953 No primer for this exon
upstream ENSMUSE00000575556 Chr10:75196365..75196521 No primer for this exon
upstream ENSMUSE00000575555 Chr10:75195145..75195260 No primer for this exon
upstream ENSMUSE00000575554 Chr10:75189603..75189764 No primer for this exon
upstream ENSMUSE00000575535 Chr10:75188344..75188500 No primer for this exon
upstream ENSMUSE00000101788 Chr10:75188294..75188500 No primer for this exon
upstream ENSMUSE00000642564 Chr10:75188004..75188149 No primer for this exon
upstream ENSMUSE00000666148 Chr10:75185506..75185529 No primer for this exon
upstream ENSMUSE00000666147 Chr10:75185272..75185288 No primer for this exon
upstream ENSMUSE00000642563 Chr10:75184023..75184284 No primer for this exon
upstream ENSMUSE00000642562 Chr10:75180183..75180443 No primer for this exon
upstream ENSMUSE00000642561 Chr10:75178344..75178495 No primer for this exon
upstream ENSMUSE00000642560 Chr10:75176198..75176376 No primer for this exon
upstream ENSMUSE00000642559 Chr10:75162658..75162840 No primer for this exon
upstream ENSMUSE00000642558 Chr10:75157460..75157791 No primer for this exon
upstream ENSMUSE00000642557 Chr10:75147037..75147150 No primer for this exon
upstream ENSMUSE00000642556 Chr10:75121379..75121542 No primer for this exon
upstream ENSMUSE00000642555 Chr10:75120541..75120637 No primer for this exon
upstream ENSMUSE00000642553 Chr10:75119520..75120197 No primer for this exon
upstream ENSMUSE00000611579 Chr10:75118111..75118185 No primer for this exon
upstream ENSMUSE00000611578 Chr10:75115620..75115887 No primer for this exon

*** Putative Vector Insertion (Chr 10: 75110967 - 75115619) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000611577 Chr10:75110802..75110966 No primer for this exon
downstream ENSMUSE00000611576 Chr10:75109620..75109846 No primer for this exon
downstream ENSMUSE00000575572 Chr10:75108855..75109432 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCCCCTTTAAGTCCTGGTA Chr10:75115615..75115635 60.31 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCCCCTTTAAGTCCTGGTA Chr10:75115615..75115635 60.31 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GGTTCTCCTAATGGCGTCCT Chr10:75112866..75112886 60.46 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGTTCTCCTAATGGCGTCCT Chr10:75112866..75112886 60.46 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020196