Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27780
Trapped Gene
Btbd16 (ENSMUSG00000040298)
Vector Insertion
Chr 7: 137933851 - 137938822
Public Clones not available
Private Clones OST49441 (lexicon)
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000303607 (Chr7:137933736..137933850 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGGCCCTGAAGAACCTCTA Chr7:137933744..137933763 59.42 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000303607 (Chr7:137933736..137933850 +)
Downstram Exon
ENSMUSE00000668964 (Chr7:137938823..137938892 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGGCCCTGAAGAACCTCTA Chr7:137933744..137933763 59.42 55 TTGGTGCGAGTCTGTTCATC Chr7:137938860..137938879 59.84 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000483300 Chr7:137917583..137917884 GGTGTCATGAGAGCGTTCAA Chr7:137917740..137917759 59.84 50
upstream ENSMUSE00000484298 Chr7:137920601..137920707 GCTCATCACTGTCCTGCTGT Chr7:137920603..137920622 59 55
upstream ENSMUSE00000303628 Chr7:137923071..137923219 ATTTCTGCGGAGACCTGTTG Chr7:137923135..137923154 60.26 50
upstream ENSMUSE00000303547 Chr7:137927775..137927848 ATGAACAGTGGCACCCAAAG Chr7:137927818..137927837 60.95 50
upstream ENSMUSE00000303618 Chr7:137929456..137929599 GGAGCTGGACAAGGTTCAGA Chr7:137929577..137929596 60.39 55
upstream ENSMUSE00000303613 Chr7:137932274..137932363 No primer for this exon
upstream ENSMUSE00000303607 Chr7:137933736..137933850 CTGGCCCTGAAGAACCTCTA Chr7:137933744..137933763 59.42 55

*** Putative Vector Insertion (Chr 7: 137933851 - 137938822) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000668964 Chr7:137938823..137938892 TTGGTGCGAGTCTGTTCATC Chr7:137938860..137938879 59.84 50
downstream ENSMUSE00000668963 Chr7:137940486..137940616 ATCTGTCGGAGGTGGATCTG Chr7:137940580..137940599 60.07 55
downstream ENSMUSE00000668962 Chr7:137949335..137949454 CCAAAATGGTCTCGTGGATT Chr7:137949444..137949463 59.79 45
downstream ENSMUSE00000668961 Chr7:137959230..137959321 AGTGGCATCCAGTTCTGTCC Chr7:137959289..137959308 60.12 55
downstream ENSMUSE00000668960 Chr7:137962532..137962614 GCTTCAACACCTCCAGATCC Chr7:137962558..137962577 59.66 55
downstream ENSMUSE00000668959 Chr7:137963952..137964029 CTAAAGAGCAGCCCGAACCT Chr7:137964028..137964047 60.88 55
downstream ENSMUSE00000668958 Chr7:137964944..137965042 GGTAGGGTCGTGTTTGATTCC Chr7:137965023..137965043 60.6 52.38
downstream ENSMUSE00000668957 Chr7:137966668..137966856 AGGGGCACTCCAAGTCTGTA Chr7:137966701..137966720 59.72 55
downstream ENSMUSE00000668956 Chr7:137967823..137969411 CTGGACGTACCCACCTGACT Chr7:137968362..137968381 60.03 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCTCACATCCTCCAGTTCA Chr7:137933816..137933836 60.4 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCTCGTGACTGGGAAAACC Chr7:137933898..137933918 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040298