Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27805
Trapped Gene
2310057J16Rik (ENSMUSG00000044433)
Vector Insertion
Chr 8: 3607891 - 3608188
Public Clones not available
Private Clones OST47641 (lexicon)
Severity of mutation (?) Insertion after 86% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000232670 (Chr8:3607791..3607890 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACGAGGCTCCCAATAACCTT Chr8:3607848..3607867 59.96 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000232670 (Chr8:3607791..3607890 +)
Downstram Exon
ENSMUSE00000210025 (Chr8:3608189..3608301 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACGAGGCTCCCAATAACCTT Chr8:3607848..3607867 59.96 50 TCCATTCTCCCAGTCACGTT Chr8:3608264..3608283 60.51 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000611125 Chr8:3587676..3587959 TCCCCGAGATCAAGTCTTTG Chr8:3587864..3587883 60.19 50
upstream ENSMUSE00000362556 Chr8:3597842..3598095 GATCAGTACGCACAGGAGCA Chr8:3597880..3597899 60.02 55
upstream ENSMUSE00000400943 Chr8:3598686..3598808 AGCTGTCATCGATGCTCTCA Chr8:3598697..3598716 59.69 50
upstream ENSMUSE00000426516 Chr8:3598893..3598988 TGCAGGAGAAGACAGAACAAGA Chr8:3598906..3598927 60.17 45.46
upstream ENSMUSE00000413235 Chr8:3600676..3600814 CTGCCACCATCCACTGCTAT Chr8:3600770..3600789 61.09 55
upstream ENSMUSE00000367515 Chr8:3601966..3602105 CTCAAGGACCCCATGTCTGT Chr8:3601974..3601993 59.96 55
upstream ENSMUSE00000364692 Chr8:3602186..3602279 TTTTGTGCAGGCCAAAGACT Chr8:3602245..3602264 60.81 45
upstream ENSMUSE00000426501 Chr8:3602371..3602425 CAGAACAACAGTGGCAGCAG Chr8:3602406..3602425 60.65 55
upstream ENSMUSE00000426499 Chr8:3602554..3602627 ACTTCCGTCACCCACTTCTG Chr8:3602568..3602587 60.15 55
upstream ENSMUSE00000408211 Chr8:3603432..3603501 CCCTGAAGTCCTCTCCATCA Chr8:3603435..3603454 60.19 55
upstream ENSMUSE00000369212 Chr8:3603606..3605076 TCCACGTCCTGTGTCAACAT Chr8:3603723..3603742 60.01 50
upstream ENSMUSE00000369927 Chr8:3606267..3606406 GACGAAGACAAGCCTGAGGA Chr8:3606267..3606286 60.53 55
upstream ENSMUSE00000411628 Chr8:3606504..3606820 GGCACAACTGAAACTGATGG Chr8:3606663..3606682 59.14 50
upstream ENSMUSE00000686571 Chr8:3606504..3606823 GGCACAACTGAAACTGATGG Chr8:3606663..3606682 59.14 50
upstream ENSMUSE00000232670 Chr8:3607791..3607890 ACGAGGCTCCCAATAACCTT Chr8:3607848..3607867 59.96 50

*** Putative Vector Insertion (Chr 8: 3607891 - 3608188) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000210025 Chr8:3608189..3608301 TCCATTCTCCCAGTCACGTT Chr8:3608264..3608283 60.51 50
downstream ENSMUSE00000210021 Chr8:3608394..3608512 GTTCTTCTGGGGCTCATTCA Chr8:3608503..3608522 60.19 50
downstream ENSMUSE00000375938 Chr8:3608598..3609047 TGGTTTTAGCAGGGATCTGG Chr8:3608811..3608830 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACGAGGCTCCCAATAACCTT Chr8:3607849..3607869 59.96 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGTCGTGACTGGGAAAACC Chr8:3607938..3607958 59.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000044433