Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27810
Trapped Gene
Gse1 (ENSMUSG00000031822)
Vector Insertion
Chr 8: 123093277 - 123094616
Public Clones not available
Private Clones OST47497 (lexicon)
Severity of mutation (?) Insertion after 45% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000303504 (Chr8:123092952..123093276 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCTGGAGCAGCACCTAGAC Chr8:123093204..123093223 60.56 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000303504 (Chr8:123092952..123093276 +)
Downstram Exon
ENSMUSE00000303484 (Chr8:123094617..123095239 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCTGGAGCAGCACCTAGAC Chr8:123093204..123093223 60.56 60 CTGAGGCTCCAGACTTCCTG Chr8:123094977..123094996 60.13 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000605789 Chr8:123012766..123013051 CTTGGACGCTGGTTTTGTTT Chr8:123012910..123012929 60.15 45
upstream ENSMUSE00000710445 Chr8:123059757..123059854 AACTAACGCGTGGACCAAAG Chr8:123059792..123059811 60.17 50
upstream ENSMUSE00000720605 Chr8:123061329..123061462 CGGGTGAGATAAGCAGTTCAG Chr8:123061373..123061393 59.88 52.38
upstream ENSMUSE00000579735 Chr8:123077484..123077702 CCCTTCCATAGGGATGCTTT Chr8:123077506..123077525 60.28 50
upstream ENSMUSE00000710125 Chr8:123077484..123077702 CCCTTCCATAGGGATGCTTT Chr8:123077506..123077525 60.28 50
upstream ENSMUSE00000213352 Chr8:123086526..123086725 AAACCGTCAATGGAGTCTGG Chr8:123086688..123086707 59.97 50
upstream ENSMUSE00000213358 Chr8:123090268..123090440 TTGTACAGGACTCCCGCTTC Chr8:123090410..123090429 60.26 55
upstream ENSMUSE00000303569 Chr8:123090827..123091024 CTTACGCATGTCCTCCTTGC Chr8:123090917..123090936 60.8 55
upstream ENSMUSE00000213364 Chr8:123091663..123091854 CGTACGGTATCCTCCTGAGC Chr8:123091774..123091793 59.72 60
upstream ENSMUSE00000371311 Chr8:123092061..123092383 GTTGCAAATGGACGAGGAAC Chr8:123092061..123092080 60.5 50
upstream ENSMUSE00000303504 Chr8:123092952..123093276 TCCTGGAGCAGCACCTAGAC Chr8:123093204..123093223 60.56 60

*** Putative Vector Insertion (Chr 8: 123093277 - 123094616) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000303484 Chr8:123094617..123095239 CTGAGGCTCCAGACTTCCTG Chr8:123094977..123094996 60.13 60
downstream ENSMUSE00000213370 Chr8:123096204..123096316 TCTCGTCGTACGAGTCATCG Chr8:123096242..123096261 60.01 55
downstream ENSMUSE00000213351 Chr8:123096536..123096806 TTCCTCTTCTCCGCACTGAT Chr8:123096807..123096826 59.95 50
downstream ENSMUSE00000213366 Chr8:123098071..123098178 GGACAGTGCTCTCTGCTTCA Chr8:123098126..123098145 59.29 55
downstream ENSMUSE00000213350 Chr8:123098834..123099205 CGTGGAATTGATGTGCAAAC Chr8:123099163..123099182 59.97 45
downstream ENSMUSE00000213354 Chr8:123100176..123100454 CTCGCTGTCCTCCTCAGAGT Chr8:123100378..123100397 59.73 60
downstream ENSMUSE00000213357 Chr8:123101871..123101974 GGCTGAGGCTGTAGTTCTGC Chr8:123101945..123101964 60.16 60
downstream ENSMUSE00000351895 Chr8:123102369..123105276 AAGGGGGCTACTGTGGTCTT Chr8:123104382..123104401 59.99 55
downstream ENSMUSE00000712712 Chr8:123102369..123103226 AGAGGAAATAACGCCGACCT Chr8:123102740..123102759 60.1 50
downstream ENSMUSE00000715807 Chr8:123102369..123103380 AACCCCCAAACAGGAAAAAC Chr8:123103316..123103335 60.07 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000031822