Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27831
Trapped Gene
Fez1 (ENSMUSG00000032118)
Vector Insertion
Chr 9: 36651603 - 36657931
Public Clones not available
Private Clones OST46468 (lexicon)
Severity of mutation (?) Insertion after 26% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000360008 (Chr9:36651247..36651602 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCTTCAAGTCCATGGAGGA Chr9:36651454..36651473 59.8 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000360008 (Chr9:36651247..36651602 +)
Downstram Exon
ENSMUSE00000226569 (Chr9:36657932..36658031 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCTTCAAGTCCATGGAGGA Chr9:36651454..36651473 59.8 50 TCAGAGCTGTTGCCATTCAG Chr9:36658027..36658046 60.14 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000637917 Chr9:36640394..36640496 CACCTCTAGTCGGTGGTTGG Chr9:36640425..36640444 60.56 60
upstream ENSMUSE00000360008 Chr9:36651247..36651602 AGCTTCAAGTCCATGGAGGA Chr9:36651454..36651473 59.8 50

*** Putative Vector Insertion (Chr 9: 36651603 - 36657931) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000226569 Chr9:36657932..36658031 TCAGAGCTGTTGCCATTCAG Chr9:36658027..36658046 60.14 50
downstream ENSMUSE00000226546 Chr9:36668397..36668483 GAGAGGCTCCTCATTGATGC Chr9:36668471..36668490 59.92 55
downstream ENSMUSE00000216694 Chr9:36671082..36671250 GACTGAATCTGCCTGGGATG Chr9:36671195..36671214 60.62 55
downstream ENSMUSE00000216708 Chr9:36675281..36675552 GCAGGCTTAACCCCTTCTCT Chr9:36675514..36675533 59.85 55
downstream ENSMUSE00000216705 Chr9:36676433..36676513 TCCTGAGGAGCCAAAGGTCT Chr9:36676504..36676523 61.3 55
downstream ENSMUSE00000584724 Chr9:36678066..36678141 CATCTGCAGGTCTTCCACAG Chr9:36678134..36678153 59.42 55
downstream ENSMUSE00000411250 Chr9:36683882..36683947 CTCCTTCATGGCGAAGAGAA Chr9:36683904..36683923 60.47 50
downstream ENSMUSE00000701629 Chr9:36686151..36686505 GAGGCTGCTCCAAAGATGAG Chr9:36686191..36686210 60.1 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAGACCAAATCCGTAGTCG Chr9:36651633..36651653 60.51 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AATTGCCTGCAAGTCTTCGT Chr9:36651637..36651657 59.88 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032118