Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27851
Trapped Gene
Sltm (ENSMUSG00000032212)
Vector Insertion
Chr 9: 70427758 - 70427863
Public Clones not available
Private Clones OST45969 (lexicon)
Severity of mutation (?) Insertion after 44% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000708786 (Chr9:70427759..70427862 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAAAAGAACGCGAGTGATCG Chr9:70427834..70427853 60.39 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000708786 (Chr9:70427759..70427862 +)
Downstram Exon
ENSMUSE00000708047 (Chr9:70427759..70427862 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAAAAGAACGCGAGTGATCG Chr9:70427834..70427853 60.39 45 CGATCACTCGCGTTCTTTTT Chr9:70427856..70427875 60.39 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000360800 Chr9:70390585..70390888 AACGGGGTCAAGACGGTACT Chr9:70390850..70390869 60.8 55
upstream ENSMUSE00000532173 Chr9:70390677..70390888 AACGGGGTCAAGACGGTACT Chr9:70390850..70390869 60.8 55
upstream ENSMUSE00000438667 Chr9:70391777..70391864 GAAACCAACCAAAGGCAAAG Chr9:70391845..70391864 59.59 45
upstream ENSMUSE00000438663 Chr9:70406844..70406908 AGTGGAGATGCTTCTGTGGAA Chr9:70406870..70406890 59.86 47.62
upstream ENSMUSE00000438628 Chr9:70409583..70409780 ATTGTGCATTCCCAGGAGTT Chr9:70409673..70409692 59.41 45
upstream ENSMUSE00000438624 Chr9:70410621..70410668 No primer for this exon
upstream ENSMUSE00000486978 Chr9:70419956..70419983 No primer for this exon
upstream ENSMUSE00000217754 Chr9:70421264..70421732 AAGCTAATGCGACTGGGAAA Chr9:70421363..70421382 59.85 45
upstream ENSMUSE00000438642 Chr9:70422383..70422432 No primer for this exon
upstream ENSMUSE00000438637 Chr9:70424529..70424647 GCAGTGGAAGCTCAACCAAG Chr9:70424553..70424572 60.97 55
upstream ENSMUSE00000395290 Chr9:70427089..70427238 CACATCTCCATCGCACAGAG Chr9:70427189..70427208 60.43 55

*** Putative Vector Insertion (Chr 9: 70427758 - 70427863) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000708047 Chr9:70427759..70427862 CGATCACTCGCGTTCTTTTT Chr9:70427856..70427875 60.39 45
downstream ENSMUSE00000708786 Chr9:70427759..70427862 CGATCACTCGCGTTCTTTTT Chr9:70427856..70427875 60.39 45
downstream ENSMUSE00000438613 Chr9:70427974..70428137 CTTGGACCATCGTCGTTCTT Chr9:70428090..70428109 60.11 50
downstream ENSMUSE00000635708 Chr9:70427974..70428137 CTTGGACCATCGTCGTTCTT Chr9:70428090..70428109 60.11 50
downstream ENSMUSE00000438606 Chr9:70428590..70428675 GACGGCCTACAATGATCTCC Chr9:70428656..70428675 59.51 55
downstream ENSMUSE00000635707 Chr9:70428590..70428675 GACGGCCTACAATGATCTCC Chr9:70428656..70428675 59.51 55
downstream ENSMUSE00000317953 Chr9:70429108..70429271 AGCCCTCTCCTTTTCTTTGC Chr9:70429143..70429162 59.96 50
downstream ENSMUSE00000635706 Chr9:70429108..70429271 AGCCCTCTCCTTTTCTTTGC Chr9:70429143..70429162 59.96 50
downstream ENSMUSE00000317935 Chr9:70431739..70431919 CTCTGTAAGCGTTCCCGTTC Chr9:70431828..70431847 59.88 55
downstream ENSMUSE00000635705 Chr9:70431739..70431919 CTCTGTAAGCGTTCCCGTTC Chr9:70431828..70431847 59.88 55
downstream ENSMUSE00000317916 Chr9:70432560..70432684 TGTTCATAGCGAAGCTGCTG Chr9:70432642..70432661 60.3 50
downstream ENSMUSE00000635704 Chr9:70432560..70432684 TGTTCATAGCGAAGCTGCTG Chr9:70432642..70432661 60.3 50
downstream ENSMUSE00000317895 Chr9:70433731..70433895 TCGCTCCAGTAAGGGTCATC Chr9:70433757..70433776 60.22 55
downstream ENSMUSE00000696296 Chr9:70433731..70433895 TCGCTCCAGTAAGGGTCATC Chr9:70433757..70433776 60.22 55
downstream ENSMUSE00000317879 Chr9:70434442..70434756 CATATTCGCTTCGCTTTTCC Chr9:70434736..70434755 59.82 45
downstream ENSMUSE00000696295 Chr9:70434442..70434756 CATATTCGCTTCGCTTTTCC Chr9:70434736..70434755 59.82 45
downstream ENSMUSE00000317866 Chr9:70434858..70435002 TGAGGCACTACTCCGATTCC Chr9:70434945..70434964 60.22 55
downstream ENSMUSE00000696292 Chr9:70434858..70435002 TGAGGCACTACTCCGATTCC Chr9:70434945..70434964 60.22 55
downstream ENSMUSE00000397078 Chr9:70436764..70436924 CATCACCCATTCGTCTTGTG Chr9:70436890..70436909 59.96 50
downstream ENSMUSE00000696288 Chr9:70436764..70436924 CATCACCCATTCGTCTTGTG Chr9:70436890..70436909 59.96 50
downstream ENSMUSE00000532159 Chr9:70439386..70440039 TACTCCGAAATGCAGGGAAC Chr9:70439936..70439955 60.07 50
downstream ENSMUSE00000696287 Chr9:70439386..70439879 GGAAGCTTGCGTTAAAATCG Chr9:70439508..70439527 59.85 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr9:70427808..70427828 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATGAGACGTGACTGGGAAA Chr9:70427802..70427822 58.64 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032212