Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27886
Trapped Gene
AW061290 (ENSMUSG00000036368)
Vector Insertion
Chr 17: 80014709 - 80020645
Public Clones not available
Private Clones OST45231 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000691707 (Chr17:80014402..80014708 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCTGGGTCAGACACGAAGG Chr17:80014557..80014576 60.11 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000691707 (Chr17:80014402..80014708 +)
Downstram Exon
ENSMUSE00000254237 (Chr17:80020646..80021112 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCTGGGTCAGACACGAAGG Chr17:80014557..80014576 60.11 55 TTCCCTCCGAATTCATCTTG Chr17:80021004..80021023 60.01 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000422799 Chr17:80014240..80014327 GGTGCAAGAAGTCTGCGTTT Chr17:80014269..80014288 60.44 50
upstream ENSMUSE00000691707 Chr17:80014402..80014708 ATCTGGGTCAGACACGAAGG Chr17:80014557..80014576 60.11 55

*** Putative Vector Insertion (Chr 17: 80014709 - 80020645) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000254237 Chr17:80020646..80021112 TTCCCTCCGAATTCATCTTG Chr17:80021004..80021023 60.01 45
downstream ENSMUSE00000392386 Chr17:80049642..80049816 ATTTGTCCGCAAATGGTCTG Chr17:80049768..80049787 60.89 45
downstream ENSMUSE00000254144 Chr17:80051039..80051141 No primer for this exon
downstream ENSMUSE00000254120 Chr17:80058753..80058813 CATGGGCGCTCTGGTAATAG Chr17:80058796..80058815 60.62 55
downstream ENSMUSE00000254098 Chr17:80066211..80066286 GTTTTGCAAGCCCTCAAACT Chr17:80066262..80066281 59.36 45
downstream ENSMUSE00000254074 Chr17:80067291..80067368 GGTTCTTCAGGCAAAAGCTG Chr17:80067334..80067353 59.99 50
downstream ENSMUSE00000254057 Chr17:80069897..80069995 AAGCTTCATGAACCGTTGAA Chr17:80069981..80070000 58.35 40
downstream ENSMUSE00000254036 Chr17:80071690..80071743 CATGGAATAACCAGGTTGCAG Chr17:80071721..80071741 60.37 47.62
downstream ENSMUSE00000254016 Chr17:80071833..80071913 GGTGACAACAGGCAGTAGCA Chr17:80071910..80071929 59.9 55
downstream ENSMUSE00000422788 Chr17:80080973..80081492 AGACGGTATTGGGTTTGCTG Chr17:80081067..80081086 59.99 50
downstream ENSMUSE00000691706 Chr17:80080973..80082152 AGACGGTATTGGGTTTGCTG Chr17:80081067..80081086 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGCAGCCCTTGGAACTAGA Chr17:80017735..80017755 59.08 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCCTCGTGACTGGGAAAAC Chr17:80017755..80017775 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036368