Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27887
Trapped Gene
Cpsf3l (ENSMUSG00000029034)
Vector Insertion
Chr 4: 155243830 - 155246235
Public Clones D155D01 (ggtc)
Private Clones OST45227 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000227769 (Chr4:155243676..155243829 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGACCATGCCCGAGATTAG Chr4:155243796..155243815 60.62 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000227769 (Chr4:155243676..155243829 +)
Downstram Exon
ENSMUSE00000227760 (Chr4:155246236..155246333 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGACCATGCCCGAGATTAG Chr4:155243796..155243815 60.62 55 ATTCTTCCCCGAAATGGAGA Chr4:155246294..155246313 60.77 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000710026 Chr4:155243655..155243829 CTGACCATGCCCGAGATTAG Chr4:155243796..155243815 60.62 55
upstream ENSMUSE00000227769 Chr4:155243676..155243829 CTGACCATGCCCGAGATTAG Chr4:155243796..155243815 60.62 55

*** Putative Vector Insertion (Chr 4: 155243830 - 155246235) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000227760 Chr4:155246236..155246333 ATTCTTCCCCGAAATGGAGA Chr4:155246294..155246313 60.77 45
downstream ENSMUSE00000227756 Chr4:155246959..155247032 GCCACTCTGGGTGATGTAAG Chr4:155247000..155247019 58.16 55
downstream ENSMUSE00000184782 Chr4:155249247..155249475 TAGATGGGTCCATCGTAGCC Chr4:155249321..155249340 59.92 55
downstream ENSMUSE00000184781 Chr4:155259207..155259305 GCCTTGATTTCCAGCTCATC Chr4:155259235..155259254 59.78 50
downstream ENSMUSE00000708795 Chr4:155259273..155259305 CAGACTCCGAGCCCACTTTA Chr4:155259297..155259316 60.39 55
downstream ENSMUSE00000227741 Chr4:155259396..155259430 CGGTCTGGGGTCATGTTATAG Chr4:155259423..155259443 59.32 52.38
downstream ENSMUSE00000184786 Chr4:155259674..155259812 CTCTGCAGCGTTTGGAATCT Chr4:155259765..155259784 60.54 50
downstream ENSMUSE00000184788 Chr4:155260201..155260265 GCAAACACAGGAATCAGCAC Chr4:155260223..155260242 59.3 50
downstream ENSMUSE00000184787 Chr4:155260907..155261096 CTGTCAGGCCCGTAGAGAAG Chr4:155260959..155260978 60.01 60
downstream ENSMUSE00000184785 Chr4:155261225..155261308 CTCATTTCCTGCCCACTTTC Chr4:155261302..155261321 59.67 50
downstream ENSMUSE00000184777 Chr4:155261541..155261630 TCCAGTTTACGTTGCCCACT Chr4:155261614..155261633 60.55 50
downstream ENSMUSE00000184780 Chr4:155261714..155261876 CCATGCACCAATAGCACACT Chr4:155261829..155261848 59.6 50
downstream ENSMUSE00000184776 Chr4:155261964..155262071 CAGCGTCACTGTCTCACCAT Chr4:155262010..155262029 59.9 55
downstream ENSMUSE00000184790 Chr4:155262157..155262218 GGGTGCCATGTAAAAGCCTA Chr4:155262204..155262223 59.96 50
downstream ENSMUSE00000184784 Chr4:155262293..155262435 ACGACAGGTGAAGCGAAGTT Chr4:155262373..155262392 59.91 50
downstream ENSMUSE00000184783 Chr4:155262505..155262634 GCAGCCTGGATTAGAATGGA Chr4:155262582..155262601 60.18 50
downstream ENSMUSE00000376215 Chr4:155262729..155263212 GGAACAACATGGGGTACCAG Chr4:155263076..155263095 60.09 55
downstream ENSMUSE00000716293 Chr4:155262729..155262794 GGCCATTTTTGAGCAATGTT Chr4:155262777..155262796 59.94 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000029034