Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27890
Trapped Gene
Rab12 (ENSMUSG00000023460)
Vector Insertion
Chr 17: 66849789 - 66855372
Public Clones not available
Private Clones OST45129 (lexicon)
Severity of mutation (?) Insertion after 49% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000540656 (Chr17:66855373..66855433 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000540656 (Chr17:66855373..66855433 -)
Downstram Exon
ENSMUSE00000277617 (Chr17:66849650..66849788 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCGAACGTCTCCTTCTTGGT Chr17:66849662..66849681 59.84 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000460119 Chr17:66868688..66869054 TCAAGCTGCAGGTCATCATC Chr17:66868773..66868792 59.95 50
upstream ENSMUSE00000540656 Chr17:66855373..66855433 No primer for this exon

*** Putative Vector Insertion (Chr 17: 66849789 - 66855372) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000277617 Chr17:66849650..66849788 TCGAACGTCTCCTTCTTGGT Chr17:66849662..66849681 59.84 50
downstream ENSMUSE00000134728 Chr17:66847359..66847448 TCCTTGCTGCCTTGAGATTT Chr17:66847343..66847362 59.96 45
downstream ENSMUSE00000277563 Chr17:66846684..66846788 TGAAATTGTCCTTGGCACTG Chr17:66846709..66846728 59.69 45
downstream ENSMUSE00000460061 Chr17:66843852..66845143 ACAGAACGTTTCCCCCTTCT Chr17:66844955..66844974 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCCCAGTCATGCCCTGTAT Chr17:66852337..66852357 59.81 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCCCAGTCATGCCCTGTAT Chr17:66852337..66852357 59.81 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023460