Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27893
Trapped Gene
Map3k10 (ENSMUSG00000040390)
Vector Insertion
Chr 7: 28444194 - 28446553
Public Clones not available
Private Clones OST45104 (lexicon)
Severity of mutation (?) Insertion after 55% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000305862 (Chr7:28446554..28446670 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGAGGAAAGGATCCGATGG Chr7:28446607..28446626 60.4 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000305862 (Chr7:28446554..28446670 -)
Downstram Exon
ENSMUSE00000305853 (Chr7:28444040..28444193 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGAGGAAAGGATCCGATGG Chr7:28446607..28446626 60.4 50 CCATGTCCTGCCTTTCTTCT Chr7:28444065..28444084 59.28 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000597857 Chr7:28458362..28459043 CTGGAGGAGATCATCGGTGT Chr7:28458727..28458746 60.07 55
upstream ENSMUSE00000676353 Chr7:28458362..28459617 CTGGAGGAGATCATCGGTGT Chr7:28458727..28458746 60.07 55
upstream ENSMUSE00000535561 Chr7:28453368..28453548 AGGCCATTGAGAACCACAAC Chr7:28453517..28453536 59.97 50
upstream ENSMUSE00000535560 Chr7:28449969..28450117 TGGCTATGAACAAGCTGACG Chr7:28450018..28450037 60.01 50
upstream ENSMUSE00000535559 Chr7:28449417..28449592 ATTTTGGCAGCATCCTGAAG Chr7:28449540..28449559 60.21 45
upstream ENSMUSE00000305867 Chr7:28448244..28448490 AGCAGCGTTTTCAGGAAGAG Chr7:28448428..28448447 59.76 50
upstream ENSMUSE00000305862 Chr7:28446554..28446670 AAGAGGAAAGGATCCGATGG Chr7:28446607..28446626 60.4 50

*** Putative Vector Insertion (Chr 7: 28444194 - 28446553) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000305853 Chr7:28444040..28444193 CCATGTCCTGCCTTTCTTCT Chr7:28444065..28444084 59.28 50
downstream ENSMUSE00000305845 Chr7:28443849..28443961 GACCACTGCTTGCTTCCTTC Chr7:28443904..28443923 60 55
downstream ENSMUSE00000305839 Chr7:28442871..28443551 AGCAATGAGCGCGTAGAGTT Chr7:28443088..28443107 60.18 50
downstream ENSMUSE00000676352 Chr7:28442716..28442721 No primer for this exon
downstream ENSMUSE00000676351 Chr7:28441683..28442005 AGGGGCACTGTATTGTCCTG Chr7:28441686..28441705 59.99 55
downstream ENSMUSE00000346718 Chr7:28441396..28442005 AGGGGCACTGTATTGTCCTG Chr7:28441686..28441705 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGTCAGCAAACCTCAGCAC Chr7:28446506..28446526 59.62 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGTCAGCAAACCTCAGCAC Chr7:28446506..28446526 59.62 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040390