Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27914
Trapped Gene
Dusp12 (ENSMUSG00000026659)
Vector Insertion
Chr 1: 172804702 - 172809790
Public Clones IST10772D9 (tigm) IST12669H8 (tigm) IST11001F3 (tigm) IST10772D9 (tigm)
IST12914C5 (tigm) IST12669H8 (tigm) IST11428A8 (tigm) IST12948B2 (tigm)
IST10770C1 (tigm) IST12508G10 (tigm)
Private Clones OST44376 (lexicon)
Severity of mutation (?) Insertion after 85% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000514238 (Chr1:172809791..172809977 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCTGTTGGGCGTTATGGAT Chr1:172809797..172809816 59.96 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000514238 (Chr1:172809791..172809977 -)
Downstram Exon
ENSMUSE00000435073 (Chr1:172804320..172804701 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCTGTTGGGCGTTATGGAT Chr1:172809797..172809816 59.96 50 GGGTTATCCATCGACCACAG Chr1:172804598..172804617 60.19 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000495810 Chr1:172815198..172815552 CTGACGGTGGACTCTGAACC Chr1:172815351..172815370 60.71 60
upstream ENSMUSE00000161686 Chr1:172811046..172811159 GTCAGTCGCAGTGTTGCTGT Chr1:172811130..172811149 60.1 55
upstream ENSMUSE00000161687 Chr1:172810704..172810822 CGATACGTCCAGTGCCTTTT Chr1:172810746..172810765 60.13 50
upstream ENSMUSE00000474519 Chr1:172810261..172810357 GGAACTCTTCGCTGTTGACC Chr1:172810319..172810338 59.85 55
upstream ENSMUSE00000515104 Chr1:172810261..172810357 GGAACTCTTCGCTGTTGACC Chr1:172810319..172810338 59.85 55
upstream ENSMUSE00000506000 Chr1:172809791..172809977 CTCTGTTGGGCGTTATGGAT Chr1:172809797..172809816 59.96 50
upstream ENSMUSE00000514238 Chr1:172809791..172809977 CTCTGTTGGGCGTTATGGAT Chr1:172809797..172809816 59.96 50

*** Putative Vector Insertion (Chr 1: 172804702 - 172809790) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000435073 Chr1:172804320..172804701 GGGTTATCCATCGACCACAG Chr1:172804598..172804617 60.19 55
downstream ENSMUSE00000593058 Chr1:172804320..172804701 GGGTTATCCATCGACCACAG Chr1:172804598..172804617 60.19 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCGTTATGGATGGACAGGTG Chr1:172806786..172806806 61.33 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCGTTATGGATGGACAGGTG Chr1:172806786..172806806 61.33 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGCTTTCCTCTTTGGTGGTT Chr1:172806982..172807002 59.71 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GTGGTTTTACAGGCGGTCTT Chr1:172809968..172809988 59.1 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026659