Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27916
Trapped Gene
Aebp2 (ENSMUSG00000030232)
Vector Insertion
Chr 6: 140604003 - 140625911
Public Clones CMHD-GT_542E12-3S (cmhd) CMHD-GT_542E12-3 (cmhd) CMHD-GT_542E12-5S (cmhd)
IST12381B2 (tigm) IST13745F2 (tigm) IST13120E3 (tigm) IST13083A7 (tigm)
IST13745F2 (tigm)
Private Clones OST44145 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000430516 (Chr6:140599277..140604002 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTATTGCCGTGTGTCTGGTG Chr6:140599946..140599965 60.03 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000430516 (Chr6:140599277..140604002 +)
Downstram Exon
ENSMUSE00000689236 (Chr6:140625912..140625939 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTATTGCCGTGTGTCTGGTG Chr6:140599946..140599965 60.03 55 TCACCTTGGGAAATTGAGGA Chr6:140625942..140625961 60.43 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000608583 Chr6:140571184..140571579 CAGCCTGCCTACAAGTGTCA Chr6:140571449..140571468 60.05 55
upstream ENSMUSE00000714143 Chr6:140572210..140572865 AGGAGGAGGATGACGAGGAG Chr6:140572334..140572353 60.75 60
upstream ENSMUSE00000716728 Chr6:140572210..140572865 AGGAGGAGGATGACGAGGAG Chr6:140572334..140572353 60.75 60
upstream ENSMUSE00000706715 Chr6:140572819..140572865 No primer for this exon
upstream ENSMUSE00000608579 Chr6:140582210..140582417 CATTCGCTCCATACATGTCG Chr6:140582381..140582400 60.1 50
upstream ENSMUSE00000608582 Chr6:140582210..140582417 CATTCGCTCCATACATGTCG Chr6:140582381..140582400 60.1 50
upstream ENSMUSE00000196633 Chr6:140586181..140586288 GTGTTCGTTTGCTTGTGGAA Chr6:140586181..140586200 59.74 45
upstream ENSMUSE00000196631 Chr6:140590693..140590879 GAATGAACAAGCGGAGGAAA Chr6:140590832..140590851 60.19 45
upstream ENSMUSE00000196630 Chr6:140592469..140592593 AGACATCGAGCCATCTGCTT Chr6:140592513..140592532 59.98 50
upstream ENSMUSE00000196629 Chr6:140595331..140595398 GCTTTTGCTTCATTGGATGC Chr6:140595369..140595388 60.73 45
upstream ENSMUSE00000196632 Chr6:140596493..140596606 CTGCCAGATGTATGGGTGAA Chr6:140596494..140596513 59.52 50
upstream ENSMUSE00000430513 Chr6:140596493..140596559 CTGCCAGATGTATGGGTGAA Chr6:140596494..140596513 59.52 50
upstream ENSMUSE00000430510 Chr6:140596561..140596606 AGATACTGCCTTGCTGTTGGA Chr6:140596571..140596591 59.89 47.62
upstream ENSMUSE00000430516 Chr6:140599277..140604002 GTATTGCCGTGTGTCTGGTG Chr6:140599946..140599965 60.03 55
upstream ENSMUSE00000546755 Chr6:140599277..140599299 No primer for this exon
upstream ENSMUSE00000608581 Chr6:140599277..140599303 CCGCAGAAGAGGTTGAAGAG Chr6:140599284..140599303 60.13 55

*** Putative Vector Insertion (Chr 6: 140604003 - 140625911) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000689236 Chr6:140625912..140625939 TCACCTTGGGAAATTGAGGA Chr6:140625942..140625961 60.43 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCAATGGACGAAGACATCC Chr6:140606991..140607011 60.08 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCAATGGACGAAGACATCC Chr6:140606991..140607011 60.08 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030232