Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27917
Trapped Gene
Hn1 (ENSMUSG00000020737)
Vector Insertion
Chr 11: 115363417 - 115364345
Public Clones not available
Private Clones OST44116 (lexicon)
Severity of mutation (?) Insertion after 43% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000257388 (Chr11:115364346..115364488 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000257388 (Chr11:115364346..115364488 -)
Downstram Exon
ENSMUSE00000108845 (Chr11:115363319..115363416 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000257397 Chr11:115375534..115375698 No primer for this exon
upstream ENSMUSE00000257388 Chr11:115364346..115364488 No primer for this exon

*** Putative Vector Insertion (Chr 11: 115363417 - 115364345) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000108845 Chr11:115363319..115363416 No primer for this exon
downstream ENSMUSE00000646221 Chr11:115361980..115361998 No primer for this exon
downstream ENSMUSE00000257359 Chr11:115358669..115359613 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATCTTTGGGACACCGGAAG Chr11:115364374..115364394 62.74 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATCTTTGGGACACCGGAAG Chr11:115364374..115364394 62.74 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020737