Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27925
Trapped Gene
OTTMUSG00000016574 (ENSMUSG00000078865)
Vector Insertion
Chr 2: 177356138 - 177356200
Public Clones not available
Private Clones OST43765 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000678580 (Chr2:177356139..177356199 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000678580 (Chr2:177356139..177356199 -)
Downstram Exon
ENSMUSE00000678575 (Chr2:177355932..177356199 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000678577 Chr2:177362835..177362915 AATGTGTTTTGAGCGCCTCT Chr2:177362881..177362900 59.88 45
upstream ENSMUSE00000678582 Chr2:177362835..177362904 AATGTGTTTTGAGCGCCTCT Chr2:177362881..177362900 59.88 45
upstream ENSMUSE00000709929 Chr2:177359674..177359728 No primer for this exon
upstream ENSMUSE00000678581 Chr2:177356392..177356518 GGCTTTGCTGGATCCTTCTC Chr2:177356449..177356468 61.24 55
upstream ENSMUSE00000678580 Chr2:177356139..177356199 No primer for this exon

*** Putative Vector Insertion (Chr 2: 177356138 - 177356200) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000678575 Chr2:177355932..177356199 No primer for this exon
downstream ENSMUSE00000711203 Chr2:177353909..177354998 AAGGTCACTCCTTCCTGCAA Chr2:177353890..177353909 59.84 50
downstream ENSMUSE00000718806 Chr2:177353909..177354998 AAGGTCACTCCTTCCTGCAA Chr2:177353890..177353909 59.84 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr2:177356129..177356149 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000078865