Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27926
Trapped Gene
Paics (ENSMUSG00000029247)
Vector Insertion
Chr 5: 77393648 - 77395271
Public Clones not available
Private Clones OST43743 (lexicon)
Severity of mutation (?) Insertion after 75% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000187309 (Chr5:77393467..77393647 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCTGCGCATAAAGGACCAG Chr5:77393595..77393614 60.24 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000187309 (Chr5:77393467..77393647 +)
Downstram Exon
ENSMUSE00000187315 (Chr5:77395272..77395430 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCTGCGCATAAAGGACCAG Chr5:77393595..77393614 60.24 50 CACTGGGCAGTCGAAGAGAT Chr5:77395433..77395452 60.41 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000722120 Chr5:77380373..77380693 GTGGGAGGCTCCGTTATTTT Chr5:77380393..77380412 60.32 50
upstream ENSMUSE00000712346 Chr5:77380393..77380426 GTGGGAGGCTCCGTTATTTT Chr5:77380393..77380412 60.32 50
upstream ENSMUSE00000710719 Chr5:77380794..77380860 GCGGTCTGCTCCTCTAGTTC Chr5:77380815..77380834 59.19 60
upstream ENSMUSE00000408986 Chr5:77380830..77380860 No primer for this exon
upstream ENSMUSE00000695715 Chr5:77383980..77383989 No primer for this exon
upstream ENSMUSE00000349614 Chr5:77385568..77385768 CATCGGGAAGAAGCTCTACG Chr5:77385578..77385597 59.97 55
upstream ENSMUSE00000485689 Chr5:77385571..77385768 CATCGGGAAGAAGCTCTACG Chr5:77385578..77385597 59.97 55
upstream ENSMUSE00000234501 Chr5:77388340..77388518 AAAGGAACCCTGGGGTACAG Chr5:77388454..77388473 60.22 55
upstream ENSMUSE00000187310 Chr5:77390135..77390314 CAGGACTGTACGCTGGTTGA Chr5:77390288..77390307 59.9 55
upstream ENSMUSE00000187314 Chr5:77390418..77390531 GACTATGGCCATCGGGAGAT Chr5:77390488..77390507 61.22 55
upstream ENSMUSE00000187313 Chr5:77391452..77391535 No primer for this exon
upstream ENSMUSE00000187309 Chr5:77393467..77393647 ATCTGCGCATAAAGGACCAG Chr5:77393595..77393614 60.24 50

*** Putative Vector Insertion (Chr 5: 77393648 - 77395271) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000187315 Chr5:77395272..77395430 CACTGGGCAGTCGAAGAGAT Chr5:77395433..77395452 60.41 55
downstream ENSMUSE00000390527 Chr5:77395673..77396528 CAAATTCAGGTCGTCTGCAA Chr5:77396296..77396315 59.84 45
downstream ENSMUSE00000709158 Chr5:77395673..77396338 CAAATTCAGGTCGTCTGCAA Chr5:77396296..77396315 59.84 45
downstream ENSMUSE00000710468 Chr5:77395673..77396534 CAAATTCAGGTCGTCTGCAA Chr5:77396296..77396315 59.84 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGCATAAAGGACCAGATGAGA Chr5:77393601..77393622 60.22 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGCATAAAGGACCAGATGAGA Chr5:77393601..77393622 60.22 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029247