Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI27936
Trapped Gene
Ttf1 (ENSMUSG00000026803)
Vector Insertion
Chr 2: 28920482 - 28920556
Public Clones (sanger) (sanger) D164B12 (ggtc) D164A12 (ggtc) IST14504G9 (tigm)
Private Clones OST43618 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000464537 (Chr2:28920146..28920481 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTCAGTGCTTGGAGAGCAA Chr2:28920245..28920264 59.85 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000464537 (Chr2:28920146..28920481 +)
Downstram Exon
ENSMUSE00000467207 (Chr2:28920557..28921428 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTCAGTGCTTGGAGAGCAA Chr2:28920245..28920264 59.85 50 ACGCACTTTTGCTGACCTTT Chr2:28920841..28920860 59.92 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000604672 Chr2:28915783..28915823 GGAAGACGAGCGCTACATTG Chr2:28915797..28915816 60.93 55
upstream ENSMUSE00000697175 Chr2:28920139..28921428 CCAGGAGAACTCGGAGAGTG Chr2:28920544..28920563 59.98 60
upstream ENSMUSE00000464537 Chr2:28920146..28920481 TCTCAGTGCTTGGAGAGCAA Chr2:28920245..28920264 59.85 50

*** Putative Vector Insertion (Chr 2: 28920482 - 28920556) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000467207 Chr2:28920557..28921428 ACGCACTTTTGCTGACCTTT Chr2:28920841..28920860 59.92 45
downstream ENSMUSE00000717651 Chr2:28922523..28922749 CTCTCGCAGCTGTCTCACTG Chr2:28922661..28922680 60.07 60
downstream ENSMUSE00000721255 Chr2:28922523..28922749 CTCTCGCAGCTGTCTCACTG Chr2:28922661..28922680 60.07 60
downstream ENSMUSE00000162972 Chr2:28925412..28925597 GAAGGCATGCTTCCGTTTTA Chr2:28925587..28925606 60.21 45
downstream ENSMUSE00000697166 Chr2:28925412..28925597 GAAGGCATGCTTCCGTTTTA Chr2:28925587..28925606 60.21 45
downstream ENSMUSE00000162970 Chr2:28926818..28926896 GCACGGTAGTACACGAGCTTC Chr2:28926862..28926882 59.96 57.14
downstream ENSMUSE00000697165 Chr2:28926818..28926896 GCACGGTAGTACACGAGCTTC Chr2:28926862..28926882 59.96 57.14
downstream ENSMUSE00000162960 Chr2:28929409..28929539 AGAGAACTTGAGGGCGACTG Chr2:28929529..28929548 59.6 55
downstream ENSMUSE00000697164 Chr2:28929409..28929539 AGAGAACTTGAGGGCGACTG Chr2:28929529..28929548 59.6 55
downstream ENSMUSE00000162954 Chr2:28930094..28930328 CACCCAAGATATGCCCTTGT Chr2:28930278..28930297 59.81 50
downstream ENSMUSE00000697163 Chr2:28930094..28930328 CACCCAAGATATGCCCTTGT Chr2:28930278..28930297 59.81 50
downstream ENSMUSE00000162968 Chr2:28934909..28934998 ACGATACACGAACCCACCAT Chr2:28934960..28934979 60.12 50
downstream ENSMUSE00000697162 Chr2:28934909..28934998 ACGATACACGAACCCACCAT Chr2:28934960..28934979 60.12 50
downstream ENSMUSE00000162971 Chr2:28936532..28936597 No primer for this exon
downstream ENSMUSE00000697161 Chr2:28936532..28936597 No primer for this exon
downstream ENSMUSE00000162962 Chr2:28939053..28939138 GCAGGCAGCTTTCAGCTTAT Chr2:28939110..28939129 59.76 50
downstream ENSMUSE00000697160 Chr2:28939053..28939138 GCAGGCAGCTTTCAGCTTAT Chr2:28939110..28939129 59.76 50
downstream ENSMUSE00000646288 Chr2:28940157..28940334 TCATCGCAATGGAAGATGTC Chr2:28940304..28940323 59.61 45
downstream ENSMUSE00000646289 Chr2:28940157..28940334 TCATCGCAATGGAAGATGTC Chr2:28940304..28940323 59.61 45
downstream ENSMUSE00000646287 Chr2:28941627..28943169 CAGCAGTATATGGGCGGTTT Chr2:28942353..28942372 59.98 50
downstream ENSMUSE00000697168 Chr2:28941627..28943169 CAGCAGTATATGGGCGGTTT Chr2:28942353..28942372 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr2:28920533..28920553 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000026803